Incidental Mutation 'R4659:Abcc9'
ID352674
Institutional Source Beutler Lab
Gene Symbol Abcc9
Ensembl Gene ENSMUSG00000030249
Gene NameATP-binding cassette, sub-family C (CFTR/MRP), member 9
SynonymsSUR2B, Sur2, SUR2A
MMRRC Submission 041919-MU
Accession Numbers

Ncbi RefSeq: NM_001044720.1; MGI: 1352630

Is this an essential gene? Probably non essential (E-score: 0.228) question?
Stock #R4659 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location142587862-142702315 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) C to A at 142672595 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000144779 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073173] [ENSMUST00000087527] [ENSMUST00000100827] [ENSMUST00000111771] [ENSMUST00000205202]
Predicted Effect probably null
Transcript: ENSMUST00000073173
SMART Domains Protein: ENSMUSP00000072914
Gene: ENSMUSG00000030249

DomainStartEndE-ValueType
transmembrane domain 28 50 N/A INTRINSIC
transmembrane domain 71 93 N/A INTRINSIC
transmembrane domain 103 125 N/A INTRINSIC
transmembrane domain 137 159 N/A INTRINSIC
transmembrane domain 169 188 N/A INTRINSIC
low complexity region 265 276 N/A INTRINSIC
Pfam:ABC_membrane 297 583 7.7e-33 PFAM
AAA 659 867 3.11e-13 SMART
coiled coil region 881 935 N/A INTRINSIC
Pfam:ABC_membrane 956 1228 6.6e-35 PFAM
AAA 1300 1502 9.94e-12 SMART
Predicted Effect probably null
Transcript: ENSMUST00000087527
SMART Domains Protein: ENSMUSP00000084805
Gene: ENSMUSG00000030249

DomainStartEndE-ValueType
transmembrane domain 28 50 N/A INTRINSIC
transmembrane domain 71 93 N/A INTRINSIC
transmembrane domain 103 125 N/A INTRINSIC
transmembrane domain 137 159 N/A INTRINSIC
transmembrane domain 169 188 N/A INTRINSIC
low complexity region 265 276 N/A INTRINSIC
Pfam:ABC_membrane 297 583 8e-33 PFAM
AAA 694 902 3.11e-13 SMART
coiled coil region 916 970 N/A INTRINSIC
Pfam:ABC_membrane 991 1263 6.8e-35 PFAM
AAA 1335 1537 9.94e-12 SMART
Predicted Effect probably null
Transcript: ENSMUST00000100827
SMART Domains Protein: ENSMUSP00000098390
Gene: ENSMUSG00000030249

DomainStartEndE-ValueType
transmembrane domain 28 50 N/A INTRINSIC
transmembrane domain 71 93 N/A INTRINSIC
transmembrane domain 103 125 N/A INTRINSIC
transmembrane domain 137 159 N/A INTRINSIC
transmembrane domain 169 188 N/A INTRINSIC
low complexity region 265 276 N/A INTRINSIC
Pfam:ABC_membrane 297 583 7.1e-35 PFAM
AAA 694 902 3.11e-13 SMART
coiled coil region 916 970 N/A INTRINSIC
Pfam:ABC_membrane 991 1263 5.2e-38 PFAM
AAA 1335 1520 5.13e-14 SMART
Predicted Effect probably null
Transcript: ENSMUST00000111771
SMART Domains Protein: ENSMUSP00000107401
Gene: ENSMUSG00000030249

DomainStartEndE-ValueType
transmembrane domain 28 50 N/A INTRINSIC
transmembrane domain 71 93 N/A INTRINSIC
transmembrane domain 103 125 N/A INTRINSIC
transmembrane domain 137 159 N/A INTRINSIC
transmembrane domain 169 188 N/A INTRINSIC
low complexity region 265 276 N/A INTRINSIC
Pfam:ABC_membrane 297 583 1.4e-32 PFAM
AAA 694 889 3.77e-12 SMART
coiled coil region 903 957 N/A INTRINSIC
Pfam:ABC_membrane 978 1250 1.2e-34 PFAM
AAA 1322 1524 9.94e-12 SMART
Predicted Effect probably null
Transcript: ENSMUST00000205202
SMART Domains Protein: ENSMUSP00000144779
Gene: ENSMUSG00000030249

DomainStartEndE-ValueType
transmembrane domain 28 50 N/A INTRINSIC
transmembrane domain 71 93 N/A INTRINSIC
transmembrane domain 103 125 N/A INTRINSIC
transmembrane domain 137 159 N/A INTRINSIC
transmembrane domain 169 188 N/A INTRINSIC
low complexity region 265 276 N/A INTRINSIC
Pfam:ABC_membrane 297 583 6.9e-35 PFAM
AAA 659 867 3.11e-13 SMART
coiled coil region 881 935 N/A INTRINSIC
Pfam:ABC_membrane 956 1228 5e-38 PFAM
AAA 1300 1502 9.94e-12 SMART
Meta Mutation Damage Score 0.6204 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 96% (74/77)
MGI Phenotype Strain: 2155916
Lethality: D42-D210
FUNCTION: The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the MRP subfamily which is involved in multi-drug resistance. The human protein is thought to form ATP-sensitive potassium channels in cardiac, skeletal, and vascular and non-vascular smooth muscle. Protein structure suggests a role as the drug-binding channel-modulating subunit of the extrapancreatic ATP-sensitive potassium channels. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jul 2015]
PHENOTYPE: Mice homozygous for a null allele display lower serum glucose, enhanced insulin action, growth retardation, hypertension and spontaneous death due to episodic coronary artery vasospasm. Homozygous exon 5 deletion leads to cardiac mitochondrial defects, cardiomyopathy, and early postnatal death. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted(4)

Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik G T 15: 8,216,276 probably benign Het
Ankrd22 C T 19: 34,125,568 V118I probably damaging Het
Aoc1 A T 6: 48,906,076 E295D probably benign Het
Arap2 T C 5: 62,654,126 N1114S possibly damaging Het
AU021092 C G 16: 5,212,147 A335P probably damaging Het
Carhsp1 T C 16: 8,664,265 T51A probably benign Het
Ccdc144b T C 3: 36,025,954 D218G possibly damaging Het
Cdc42bpb T C 12: 111,339,891 D152G probably damaging Het
Cep70 T A 9: 99,296,341 D497E possibly damaging Het
Chrm5 T C 2: 112,479,757 N338S probably benign Het
Cldn8 G A 16: 88,562,408 H210Y probably benign Het
Clhc1 T A 11: 29,578,229 *586K probably null Het
Dopey1 T A 9: 86,502,032 probably benign Het
Dync1h1 T C 12: 110,628,767 F1371S possibly damaging Het
Eif6 A G 2: 155,826,181 I46T probably damaging Het
Esco2 G A 14: 65,826,586 T383M possibly damaging Het
Exoc8 T C 8: 124,897,532 D32G probably damaging Het
Fam149b G T 14: 20,367,873 S216I probably benign Het
Fam219a T C 4: 41,521,645 D87G probably null Het
Fbxw26 A T 9: 109,744,871 V71D probably damaging Het
Gabra4 T A 5: 71,641,144 K164M probably damaging Het
Gm8603 G A 17: 13,517,028 noncoding transcript Het
Gnmt A G 17: 46,725,966 F239S probably damaging Het
Gpsm1 G A 2: 26,319,831 probably benign Het
Jam2 G A 16: 84,812,952 V151M probably damaging Het
Kcnj1 A T 9: 32,394,148 D2V probably benign Het
Limch1 C T 5: 67,027,557 R797C probably damaging Het
Lrrc9 T A 12: 72,470,264 F597I probably damaging Het
Lrriq3 T A 3: 155,129,453 I275N possibly damaging Het
Mcoln1 T A 8: 3,510,840 S387R probably damaging Het
Mgst3 T A 1: 167,377,279 Q58L probably damaging Het
Mical1 G A 10: 41,486,936 probably benign Het
Mmp3 C A 9: 7,453,673 D431E probably benign Het
Mx1 T C 16: 97,455,239 probably null Het
Myo7a A G 7: 98,085,466 L607P probably damaging Het
Myt1l A G 12: 29,849,457 N153D probably damaging Het
Nfu1 A T 6: 87,019,426 T120S probably damaging Het
Nhlrc2 T C 19: 56,576,267 V341A possibly damaging Het
Notch1 T C 2: 26,470,889 E1148G probably damaging Het
Nqo1 C T 8: 107,391,044 probably null Het
Nwd1 T A 8: 72,695,321 D998E probably benign Het
Olfr1049 G A 2: 86,255,013 Q227* probably null Het
Oxct2a T C 4: 123,322,680 I303V probably benign Het
Parp10 A T 15: 76,242,985 D58E probably damaging Het
Pcdha6 T A 18: 36,969,239 V495E probably damaging Het
Pitrm1 T A 13: 6,553,182 S88R probably benign Het
Pxdn T C 12: 29,994,553 V510A probably benign Het
Ranbp17 T A 11: 33,266,288 D820V probably damaging Het
Sec24c G T 14: 20,683,144 G180C probably damaging Het
Serpina3n T C 12: 104,413,493 S382P probably benign Het
Sestd1 A T 2: 77,212,499 M237K probably null Het
Sf3a2 T C 10: 80,803,584 I136T probably damaging Het
Sh3tc2 A G 18: 61,974,509 Y197C probably benign Het
Speer4b T C 5: 27,497,895 K204E probably benign Het
Speer4f1 A C 5: 17,476,223 E33A possibly damaging Het
Sspo T A 6: 48,484,213 D3529E probably damaging Het
Stard13 T C 5: 151,062,788 D419G probably benign Het
Tg A G 15: 66,673,920 S164G possibly damaging Het
Thap12 A G 7: 98,710,091 probably benign Het
Thsd1 C A 8: 22,259,298 Y667* probably null Het
Tnks A C 8: 34,849,311 Y885D possibly damaging Het
Ttll3 A G 6: 113,414,141 I896V probably benign Het
Txnip T G 3: 96,559,427 F190C probably damaging Het
Urb1 T C 16: 90,776,129 D1005G probably damaging Het
Usp3 T C 9: 66,527,070 probably null Het
Usp54 G T 14: 20,564,992 Q794K probably damaging Het
Xrn2 A G 2: 147,061,474 Q798R probably benign Het
Zfp189 A G 4: 49,530,342 I482V probably benign Het
Zfp28 A G 7: 6,393,507 N314D probably benign Het
Zmym4 A G 4: 126,948,428 probably null Het
Other mutations in Abcc9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Abcc9 APN 6 142633190 splice site probably benign
IGL00670:Abcc9 APN 6 142687281 missense probably damaging 1.00
IGL00675:Abcc9 APN 6 142664621 missense probably damaging 1.00
IGL00741:Abcc9 APN 6 142687230 missense probably benign
IGL01371:Abcc9 APN 6 142656614 missense probably benign 0.04
IGL01686:Abcc9 APN 6 142603075 missense possibly damaging 0.71
IGL01724:Abcc9 APN 6 142664533 missense probably benign 0.00
IGL01807:Abcc9 APN 6 142605914 missense probably damaging 1.00
IGL01941:Abcc9 APN 6 142605904 missense probably damaging 1.00
IGL01946:Abcc9 APN 6 142626037 missense probably benign 0.16
IGL02210:Abcc9 APN 6 142687371 missense probably damaging 1.00
IGL02498:Abcc9 APN 6 142671539 critical splice donor site probably null
IGL02535:Abcc9 APN 6 142628426 missense probably benign 0.00
IGL02552:Abcc9 APN 6 142605919 missense possibly damaging 0.94
IGL02812:Abcc9 APN 6 142697790 missense possibly damaging 0.77
IGL02954:Abcc9 APN 6 142646281 missense probably damaging 0.97
IGL03035:Abcc9 APN 6 142627593 missense probably damaging 1.00
IGL03040:Abcc9 APN 6 142652597 nonsense probably null
IGL03100:Abcc9 APN 6 142694544 missense probably damaging 1.00
IGL03157:Abcc9 APN 6 142605923 splice site probably benign
R0054:Abcc9 UTSW 6 142601774 critical splice donor site probably null
R0054:Abcc9 UTSW 6 142601774 critical splice donor site probably null
R0084:Abcc9 UTSW 6 142658551 missense probably damaging 0.97
R0211:Abcc9 UTSW 6 142688984 missense probably benign 0.01
R0349:Abcc9 UTSW 6 142664625 missense probably benign 0.00
R0387:Abcc9 UTSW 6 142639504 nonsense probably null
R0393:Abcc9 UTSW 6 142645878 splice site probably benign
R0528:Abcc9 UTSW 6 142692880 missense probably damaging 1.00
R0588:Abcc9 UTSW 6 142603061 nonsense probably null
R0646:Abcc9 UTSW 6 142682104 missense probably benign 0.05
R0691:Abcc9 UTSW 6 142639253 missense possibly damaging 0.94
R0881:Abcc9 UTSW 6 142646303 missense probably damaging 1.00
R1264:Abcc9 UTSW 6 142646377 splice site probably benign
R1340:Abcc9 UTSW 6 142682855 splice site probably benign
R1413:Abcc9 UTSW 6 142590496 missense probably damaging 1.00
R1413:Abcc9 UTSW 6 142627519 missense possibly damaging 0.65
R1535:Abcc9 UTSW 6 142664635 missense probably damaging 1.00
R1595:Abcc9 UTSW 6 142633095 missense probably benign 0.02
R1670:Abcc9 UTSW 6 142594722 missense possibly damaging 0.89
R1769:Abcc9 UTSW 6 142627468 splice site probably benign
R1888:Abcc9 UTSW 6 142679314 missense probably benign
R1888:Abcc9 UTSW 6 142679314 missense probably benign
R1918:Abcc9 UTSW 6 142697682 missense probably damaging 1.00
R1925:Abcc9 UTSW 6 142671607 missense probably damaging 0.98
R2019:Abcc9 UTSW 6 142675434 missense probably damaging 1.00
R2698:Abcc9 UTSW 6 142633136 missense possibly damaging 0.93
R2860:Abcc9 UTSW 6 142626010 missense probably benign 0.01
R2861:Abcc9 UTSW 6 142626010 missense probably benign 0.01
R2980:Abcc9 UTSW 6 142687308 missense probably benign 0.00
R3115:Abcc9 UTSW 6 142689029 missense probably benign 0.08
R3617:Abcc9 UTSW 6 142679289 missense probably damaging 0.97
R3880:Abcc9 UTSW 6 142639233 missense probably damaging 1.00
R4063:Abcc9 UTSW 6 142605919 missense possibly damaging 0.94
R4065:Abcc9 UTSW 6 142645890 missense probably damaging 1.00
R4290:Abcc9 UTSW 6 142594012 missense probably benign 0.08
R4538:Abcc9 UTSW 6 142614412 critical splice donor site probably null
R4615:Abcc9 UTSW 6 142689107 missense possibly damaging 0.93
R4774:Abcc9 UTSW 6 142639317 missense probably damaging 1.00
R4788:Abcc9 UTSW 6 142620730 nonsense probably null
R4832:Abcc9 UTSW 6 142671556 missense probably damaging 1.00
R4844:Abcc9 UTSW 6 142689098 missense probably benign 0.09
R4903:Abcc9 UTSW 6 142600965 missense probably damaging 1.00
R4921:Abcc9 UTSW 6 142590436 missense probably benign
R4960:Abcc9 UTSW 6 142620783 splice site probably null
R4983:Abcc9 UTSW 6 142682141 missense probably benign 0.44
R4986:Abcc9 UTSW 6 142627591 missense probably benign 0.00
R5060:Abcc9 UTSW 6 142626110 intron probably benign
R5120:Abcc9 UTSW 6 142656618 missense probably benign 0.00
R5198:Abcc9 UTSW 6 142626000 missense probably benign 0.00
R5301:Abcc9 UTSW 6 142590481 missense probably benign 0.41
R5328:Abcc9 UTSW 6 142682059 missense probably benign 0.25
R5568:Abcc9 UTSW 6 142689016 missense possibly damaging 0.62
R5654:Abcc9 UTSW 6 142625645 intron probably benign
R5694:Abcc9 UTSW 6 142600947 missense probably damaging 1.00
R5734:Abcc9 UTSW 6 142625731 intron probably benign
R5774:Abcc9 UTSW 6 142628559 missense probably damaging 0.98
R5802:Abcc9 UTSW 6 142656676 critical splice acceptor site probably null
R5890:Abcc9 UTSW 6 142604828 critical splice donor site probably null
R5946:Abcc9 UTSW 6 142625952 missense probably damaging 1.00
R5971:Abcc9 UTSW 6 142639575 missense probably damaging 1.00
R6078:Abcc9 UTSW 6 142639575 missense probably damaging 1.00
R6392:Abcc9 UTSW 6 142682099 missense probably damaging 1.00
R6400:Abcc9 UTSW 6 142692709 makesense probably null
R6478:Abcc9 UTSW 6 142679308 missense probably damaging 1.00
R6481:Abcc9 UTSW 6 142604895 missense probably damaging 0.99
R6564:Abcc9 UTSW 6 142603108 missense probably damaging 1.00
R6700:Abcc9 UTSW 6 142687287 missense possibly damaging 0.94
R6902:Abcc9 UTSW 6 142679227 missense probably damaging 1.00
R6946:Abcc9 UTSW 6 142679227 missense probably damaging 1.00
R6989:Abcc9 UTSW 6 142688981 missense probably damaging 0.97
R7052:Abcc9 UTSW 6 142658535 missense probably benign 0.00
R7062:Abcc9 UTSW 6 142599146 missense probably damaging 1.00
R7121:Abcc9 UTSW 6 142689127 nonsense probably null
U15987:Abcc9 UTSW 6 142639575 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCAGGTATGATCAAGTTGGAGACG -3'
(R):5'- AGCGGGGAGAATTGTTTCCG -3'

Sequencing Primer
(F):5'- CGAAGGGTTTCCTCTTACAGCAAAG -3'
(R):5'- AGAATTGTTTCCGAGGTCATTGATG -3'
Posted On2015-10-08