Incidental Mutation 'R4169:Klk14'
ID320691
Institutional Source Beutler Lab
Gene Symbol Klk14
Ensembl Gene ENSMUSG00000044737
Gene Namekallikrein related-peptidase 14
Synonyms
MMRRC Submission 041010-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4169 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location43690418-43695536 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 43692077 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Tyrosine at position 51 (C51Y)
Ref Sequence ENSEMBL: ENSMUSP00000056935 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056329]
Predicted Effect probably damaging
Transcript: ENSMUST00000056329
AA Change: C51Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000056935
Gene: ENSMUSG00000044737
AA Change: C51Y

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
Tryp_SPc 23 243 2.02e-93 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181454
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205416
Meta Mutation Damage Score 0.628 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.8%
Validation Efficiency 98% (48/49)
MGI Phenotype FUNCTION: This gene encodes a member of the kallikrein subfamily of serine proteases that have diverse physiological functions such as regulation of blood pressure and desquamation. The encoded protein is a precursor that undergoes proteolytic cleavage of the activation peptide to generate the functional enzyme. The encoded enzyme was found to activate the complement pathway by cleavage of C3 to release C3a anaphylotoxin. This gene is one of the several glandular kallikrein genes located in a cluster on chromosome 7. [provided by RefSeq, Aug 2015]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acot7 T C 4: 152,217,793 C121R probably damaging Het
Ampd1 T A 3: 103,094,841 M546K probably damaging Het
Birc3 T A 9: 7,849,683 D535V possibly damaging Het
Btn1a1 A G 13: 23,465,155 L9P probably benign Het
Cmip A T 8: 117,456,917 N743I probably damaging Het
Col4a2 C T 8: 11,429,391 P758L probably benign Het
Ddx50 A T 10: 62,640,770 Y241* probably null Het
Elk3 A G 10: 93,265,335 probably null Het
Fbn1 T C 2: 125,363,952 T1042A possibly damaging Het
Gm5445 A G 13: 12,378,646 noncoding transcript Het
Gnat3 T C 5: 18,003,864 F189L probably damaging Het
Hectd1 T C 12: 51,790,225 T815A probably damaging Het
Hmcn1 A C 1: 150,595,999 probably null Het
Hrc A G 7: 45,336,757 D444G probably benign Het
Ighv1-53 T A 12: 115,158,546 I70F possibly damaging Het
Kat7 A G 11: 95,280,472 F469L probably damaging Het
Krt81 T A 15: 101,461,312 M242L probably benign Het
Krtap6-1 A G 16: 89,031,696 probably null Het
Man2c1 A G 9: 57,138,026 D473G probably benign Het
Mthfr-ps1 T C 5: 78,474,589 noncoding transcript Het
Nop53 A T 7: 15,942,319 W152R probably benign Het
Olfr220 T A 1: 174,449,596 S324R unknown Het
Olfr281 A G 15: 98,456,997 E229G probably benign Het
Olfr482 A T 7: 108,095,384 M62K probably damaging Het
Pcdh1 A T 18: 38,198,305 N548K probably damaging Het
Pcdhga12 A G 18: 37,766,414 I100V probably benign Het
Piezo2 T C 18: 63,050,604 H1743R probably benign Het
Pkdrej A G 15: 85,816,314 V1807A probably benign Het
Rabl2 T C 15: 89,590,379 M1V probably null Het
Rexo5 A G 7: 119,827,398 probably benign Het
Rfng C G 11: 120,783,946 G73R probably benign Het
Rps6ka4 A G 19: 6,831,820 L459P possibly damaging Het
Samd11 T A 4: 156,247,746 D536V probably damaging Het
Slc9a5 A G 8: 105,357,400 T451A possibly damaging Het
Snapc1 T A 12: 73,982,491 N349K probably benign Het
Sox1ot A G 8: 12,430,544 noncoding transcript Het
Tmem178 C T 17: 80,944,803 H39Y possibly damaging Het
Trav8n-2 A T 14: 53,346,418 T111S possibly damaging Het
Ttn T A 2: 76,872,759 probably benign Het
Ttn T C 2: 76,932,565 D3250G probably damaging Het
Ube2nl T A 7: 61,549,632 noncoding transcript Het
Vps25 T C 11: 101,254,092 S39P probably damaging Het
Zkscan14 G A 5: 145,196,175 T182I possibly damaging Het
Other mutations in Klk14
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0309:Klk14 UTSW 7 43694345 missense probably benign 0.01
R0467:Klk14 UTSW 7 43694110 missense probably benign 0.33
R1432:Klk14 UTSW 7 43694918 missense probably damaging 1.00
R1575:Klk14 UTSW 7 43693953 critical splice acceptor site probably null
R2160:Klk14 UTSW 7 43692077 missense probably damaging 1.00
R2185:Klk14 UTSW 7 43692077 missense probably damaging 1.00
R2188:Klk14 UTSW 7 43692077 missense probably damaging 1.00
R2189:Klk14 UTSW 7 43692077 missense probably damaging 1.00
R2472:Klk14 UTSW 7 43692077 missense probably damaging 1.00
R2474:Klk14 UTSW 7 43692077 missense probably damaging 1.00
R2961:Klk14 UTSW 7 43692077 missense probably damaging 1.00
R2962:Klk14 UTSW 7 43692077 missense probably damaging 1.00
R2968:Klk14 UTSW 7 43692077 missense probably damaging 1.00
R3147:Klk14 UTSW 7 43692077 missense probably damaging 1.00
R3148:Klk14 UTSW 7 43692077 missense probably damaging 1.00
R3176:Klk14 UTSW 7 43692077 missense probably damaging 1.00
R3177:Klk14 UTSW 7 43692077 missense probably damaging 1.00
R3276:Klk14 UTSW 7 43692077 missense probably damaging 1.00
R3277:Klk14 UTSW 7 43692077 missense probably damaging 1.00
R3418:Klk14 UTSW 7 43692077 missense probably damaging 1.00
R3419:Klk14 UTSW 7 43692077 missense probably damaging 1.00
R3430:Klk14 UTSW 7 43692077 missense probably damaging 1.00
R3956:Klk14 UTSW 7 43692077 missense probably damaging 1.00
R4080:Klk14 UTSW 7 43692077 missense probably damaging 1.00
R4081:Klk14 UTSW 7 43692077 missense probably damaging 1.00
R4152:Klk14 UTSW 7 43692077 missense probably damaging 1.00
R4153:Klk14 UTSW 7 43692077 missense probably damaging 1.00
R4205:Klk14 UTSW 7 43694934 missense probably benign 0.00
R4284:Klk14 UTSW 7 43692077 missense probably damaging 1.00
R4285:Klk14 UTSW 7 43692077 missense probably damaging 1.00
R4287:Klk14 UTSW 7 43692077 missense probably damaging 1.00
R4356:Klk14 UTSW 7 43692077 missense probably damaging 1.00
R4359:Klk14 UTSW 7 43692077 missense probably damaging 1.00
R4379:Klk14 UTSW 7 43692077 missense probably damaging 1.00
R4380:Klk14 UTSW 7 43692077 missense probably damaging 1.00
R4381:Klk14 UTSW 7 43692077 missense probably damaging 1.00
R4611:Klk14 UTSW 7 43694357 missense probably damaging 1.00
R4684:Klk14 UTSW 7 43691968 missense probably benign
R4784:Klk14 UTSW 7 43692077 missense probably damaging 1.00
R4792:Klk14 UTSW 7 43692077 missense probably damaging 1.00
R4793:Klk14 UTSW 7 43692077 missense probably damaging 1.00
R4825:Klk14 UTSW 7 43692076 missense probably damaging 1.00
R4844:Klk14 UTSW 7 43692077 missense probably damaging 1.00
R4847:Klk14 UTSW 7 43692077 missense probably damaging 1.00
R4884:Klk14 UTSW 7 43692077 missense probably damaging 1.00
R4898:Klk14 UTSW 7 43692077 missense probably damaging 1.00
R4941:Klk14 UTSW 7 43692077 missense probably damaging 1.00
R4942:Klk14 UTSW 7 43692077 missense probably damaging 1.00
R4943:Klk14 UTSW 7 43692077 missense probably damaging 1.00
R4972:Klk14 UTSW 7 43692077 missense probably damaging 1.00
R4997:Klk14 UTSW 7 43692077 missense probably damaging 1.00
R5021:Klk14 UTSW 7 43692077 missense probably damaging 1.00
R5022:Klk14 UTSW 7 43692077 missense probably damaging 1.00
R5024:Klk14 UTSW 7 43692077 missense probably damaging 1.00
R5053:Klk14 UTSW 7 43692077 missense probably damaging 1.00
R5054:Klk14 UTSW 7 43692077 missense probably damaging 1.00
R5056:Klk14 UTSW 7 43692077 missense probably damaging 1.00
R5057:Klk14 UTSW 7 43692077 missense probably damaging 1.00
R5097:Klk14 UTSW 7 43692077 missense probably damaging 1.00
R5253:Klk14 UTSW 7 43692077 missense probably damaging 1.00
R5257:Klk14 UTSW 7 43692077 missense probably damaging 1.00
R5459:Klk14 UTSW 7 43692077 missense probably damaging 1.00
R5489:Klk14 UTSW 7 43692077 missense probably damaging 1.00
R5490:Klk14 UTSW 7 43692077 missense probably damaging 1.00
R5493:Klk14 UTSW 7 43692077 missense probably damaging 1.00
R5543:Klk14 UTSW 7 43692077 missense probably damaging 1.00
R6823:Klk14 UTSW 7 43694456 nonsense probably null
X0064:Klk14 UTSW 7 43694110 missense probably benign 0.33
Predicted Primers PCR Primer
(F):5'- AAGATCTCTGTCTGCTGGGC -3'
(R):5'- GATGGCAAGGGTTCTACATACAC -3'

Sequencing Primer
(F):5'- ATCTCTGTCTGCTGGGCATTGG -3'
(R):5'- TGAATTATGCCTCTCAGCCTAG -3'
Posted On2015-06-12