Incidental Mutation 'R4169:Birc3'
ID320700
Institutional Source Beutler Lab
Gene Symbol Birc3
Ensembl Gene ENSMUSG00000032000
Gene Namebaculoviral IAP repeat-containing 3
SynonymsApi2, cIAP2, cIAP-2, HIAP2, IAP2, MIAP2, MIHC, RNF49
MMRRC Submission 041010-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.511) question?
Stock #R4169 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location7848699-7873186 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 7849683 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 535 (D535V)
Ref Sequence ENSEMBL: ENSMUSP00000013949 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000013949]
Predicted Effect possibly damaging
Transcript: ENSMUST00000013949
AA Change: D535V

PolyPhen 2 Score 0.781 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000013949
Gene: ENSMUSG00000032000
AA Change: D535V

DomainStartEndE-ValueType
BIR 27 98 1.92e-34 SMART
low complexity region 132 145 N/A INTRINSIC
BIR 167 237 2.12e-36 SMART
BIR 253 324 1.5e-36 SMART
CARD 438 525 7.29e-4 SMART
RING 555 589 1.43e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000161642
SMART Domains Protein: ENSMUSP00000125512
Gene: ENSMUSG00000032000

DomainStartEndE-ValueType
SCOP:d1g73d_ 4 35 1e-6 SMART
PDB:3T6P|A 4 106 2e-39 PDB
low complexity region 107 125 N/A INTRINSIC
Meta Mutation Damage Score 0.0656 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.8%
Validation Efficiency 98% (48/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the IAP family of proteins that inhibit apoptosis by binding to tumor necrosis factor receptor-associated factors TRAF1 and TRAF2, probably by interfering with activation of ICE-like proteases. The encoded protein inhibits apoptosis induced by serum deprivation but does not affect apoptosis resulting from exposure to menadione, a potent inducer of free radicals. It contains 3 baculovirus IAP repeats and a ring finger domain. Transcript variants encoding the same isoform have been identified. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for disruptions in this gene have a reduced susceptibility to endotoxic shock. Mice homozygous for a knock-in allele exhibit increased B cell survival and proliferation, lymph node hyperplasia, lymphocytic infiltrates in the lungs, and enlarged gut-associated lympoid tissue. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acot7 T C 4: 152,217,793 C121R probably damaging Het
Ampd1 T A 3: 103,094,841 M546K probably damaging Het
Btn1a1 A G 13: 23,465,155 L9P probably benign Het
Cmip A T 8: 117,456,917 N743I probably damaging Het
Col4a2 C T 8: 11,429,391 P758L probably benign Het
Ddx50 A T 10: 62,640,770 Y241* probably null Het
Elk3 A G 10: 93,265,335 probably null Het
Fbn1 T C 2: 125,363,952 T1042A possibly damaging Het
Gm5445 A G 13: 12,378,646 noncoding transcript Het
Gnat3 T C 5: 18,003,864 F189L probably damaging Het
Hectd1 T C 12: 51,790,225 T815A probably damaging Het
Hmcn1 A C 1: 150,595,999 probably null Het
Hrc A G 7: 45,336,757 D444G probably benign Het
Ighv1-53 T A 12: 115,158,546 I70F possibly damaging Het
Kat7 A G 11: 95,280,472 F469L probably damaging Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Krt81 T A 15: 101,461,312 M242L probably benign Het
Krtap6-1 A G 16: 89,031,696 probably null Het
Man2c1 A G 9: 57,138,026 D473G probably benign Het
Mthfr-ps1 T C 5: 78,474,589 noncoding transcript Het
Nop53 A T 7: 15,942,319 W152R probably benign Het
Olfr220 T A 1: 174,449,596 S324R unknown Het
Olfr281 A G 15: 98,456,997 E229G probably benign Het
Olfr482 A T 7: 108,095,384 M62K probably damaging Het
Pcdh1 A T 18: 38,198,305 N548K probably damaging Het
Pcdhga12 A G 18: 37,766,414 I100V probably benign Het
Piezo2 T C 18: 63,050,604 H1743R probably benign Het
Pkdrej A G 15: 85,816,314 V1807A probably benign Het
Rabl2 T C 15: 89,590,379 M1V probably null Het
Rexo5 A G 7: 119,827,398 probably benign Het
Rfng C G 11: 120,783,946 G73R probably benign Het
Rps6ka4 A G 19: 6,831,820 L459P possibly damaging Het
Samd11 T A 4: 156,247,746 D536V probably damaging Het
Slc9a5 A G 8: 105,357,400 T451A possibly damaging Het
Snapc1 T A 12: 73,982,491 N349K probably benign Het
Sox1ot A G 8: 12,430,544 noncoding transcript Het
Tmem178 C T 17: 80,944,803 H39Y possibly damaging Het
Trav8n-2 A T 14: 53,346,418 T111S possibly damaging Het
Ttn T A 2: 76,872,759 probably benign Het
Ttn T C 2: 76,932,565 D3250G probably damaging Het
Ube2nl T A 7: 61,549,632 noncoding transcript Het
Vps25 T C 11: 101,254,092 S39P probably damaging Het
Zkscan14 G A 5: 145,196,175 T182I possibly damaging Het
Other mutations in Birc3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01329:Birc3 APN 9 7860732 missense probably damaging 1.00
IGL02852:Birc3 APN 9 7854483 missense probably damaging 0.99
IGL03135:Birc3 APN 9 7849721 splice site probably benign
R0478:Birc3 UTSW 9 7860347 missense probably damaging 1.00
R0905:Birc3 UTSW 9 7851051 makesense probably null
R1934:Birc3 UTSW 9 7854499 missense possibly damaging 0.89
R2005:Birc3 UTSW 9 7860341 missense probably damaging 1.00
R3019:Birc3 UTSW 9 7857389 critical splice donor site probably null
R4964:Birc3 UTSW 9 7860552 missense probably benign 0.01
R5338:Birc3 UTSW 9 7857359 missense probably benign 0.01
R5395:Birc3 UTSW 9 7861174 missense probably damaging 1.00
R5877:Birc3 UTSW 9 7849346 missense probably damaging 1.00
R5914:Birc3 UTSW 9 7857342 makesense probably null
R6148:Birc3 UTSW 9 7849683 missense possibly damaging 0.78
R6471:Birc3 UTSW 9 7857420 missense probably benign 0.00
R6747:Birc3 UTSW 9 7860261 critical splice donor site probably null
R6752:Birc3 UTSW 9 7857344 missense probably benign 0.10
R6812:Birc3 UTSW 9 7854417 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CGCCTCCAGTTTCCAAGCAC -3'
(R):5'- CGTGCACATGAAATAAATACAGTTGC -3'

Sequencing Primer
(F):5'- ACTGGTCCCACGGCATATGATG -3'
(R):5'- CTACAATCACAGTATCCAGGAGGTTG -3'
Posted On2015-06-12