Mutagenetix > Incidental Mutation

Incidental Mutation 'R4360:Chd6'

324843

Institutional Source

Beutler Lab

Gene Symbol

Chd6

Ensembl Gene

ENSMUSG00000057133

Gene Name

chromodomain helicase DNA binding protein 6

Synonyms

5430439G14Rik, 6330406J24Rik

MMRRC Submission

041111-MU

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.745) question?

Stock #

R4360 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

160788898-160950995 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 160791776 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 2527 (V2527A)

Ref Sequence

ENSEMBL: ENSMUSP00000042291 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000039782]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000039782
AA Change: V2527A

PolyPhen 2 Score 0.478 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000042291
Gene: ENSMUSG00000057133
AA Change: V2527A

Domain	Start	End	E-Value	Type
low complexity region	86	106	N/A	INTRINSIC
low complexity region	113	143	N/A	INTRINSIC
low complexity region	214	229	N/A	INTRINSIC
CHROMO	289	355	1.35e-4	SMART
CHROMO	372	430	3.48e-7	SMART
DEXDc	456	658	1.73e-39	SMART
HELICc	812	896	3.84e-23	SMART
low complexity region	1080	1094	N/A	INTRINSIC
Blast:DEXDc	1108	1153	4e-23	BLAST
SANT	1445	1504	1.51e0	SMART
low complexity region	1866	1875	N/A	INTRINSIC
low complexity region	2048	2057	N/A	INTRINSIC
low complexity region	2130	2140	N/A	INTRINSIC
low complexity region	2277	2290	N/A	INTRINSIC
low complexity region	2333	2349	N/A	INTRINSIC
low complexity region	2437	2446	N/A	INTRINSIC
low complexity region	2539	2563	N/A	INTRINSIC
low complexity region	2652	2659	N/A	INTRINSIC

Meta Mutation Damage Score

0.0890

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.1%
20x: 94.6%

Validation Efficiency

100% (50/50)

MGI Phenotype

FUNCTION: This gene encodes a member of the chromodomain/helicase/DNA-binding domain family of chromatin remodeling enzymes. This protein has been found to be specifically involved in transcription initiation and elongation. Homozygous knockout mice exhibit impaired motor coordination. A pseudogene has been identified on chromosome 8. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Nov 2014]
PHENOTYPE: Homozygous null mice display impaired coordination that is not due to muscle weakness or bradykinesia. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 43 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930578I07Rik	T	C	14: 67,175,850 (GRCm39)		noncoding transcript	Het
Adgra3	T	C	5: 50,147,552 (GRCm39)	E496G	possibly damaging	Het
Atg14	C	G	14: 47,805,827 (GRCm39)	E13Q	probably benign	Het
BC023105	G	T	18: 60,575,073 (GRCm39)		noncoding transcript	Het
Csn1s2a	G	T	5: 87,929,700 (GRCm39)	V100L	possibly damaging	Het
Fah	G	A	7: 84,238,856 (GRCm39)	L330F	probably damaging	Het
Fmo2	T	C	1: 162,709,583 (GRCm39)	N268S	probably damaging	Het
Foxg1	CCAGCAGCAGCAGCAGCAGC	CCAGCAGCAGCAGCAGC	12: 49,431,475 (GRCm39)		probably benign	Het
Frmd4a	A	T	2: 4,606,052 (GRCm39)	H287L	probably damaging	Het
G2e3	T	A	12: 51,410,197 (GRCm39)		probably benign	Het
Gm1758	A	T	16: 14,324,215 (GRCm39)		noncoding transcript	Het
Gm7204	T	C	16: 48,039,196 (GRCm39)		noncoding transcript	Het
Gm829	T	C	4: 45,718,819 (GRCm39)		noncoding transcript	Het
Hspa14	A	G	2: 3,503,560 (GRCm39)	V116A	possibly damaging	Het
Hspa4	T	C	11: 53,155,919 (GRCm39)	Y662C	probably damaging	Het
Islr	T	A	9: 58,064,887 (GRCm39)	N207Y	probably damaging	Het
Lipc	T	C	9: 70,759,864 (GRCm39)		probably benign	Het
Ncor2	A	G	5: 125,106,036 (GRCm39)	S1546P	probably damaging	Het
Or13a25	T	C	7: 140,247,730 (GRCm39)	F170L	probably damaging	Het
Or56a3	A	C	7: 104,735,460 (GRCm39)	E179A	probably damaging	Het
Or7g18	G	A	9: 18,787,013 (GRCm39)	C127Y	probably damaging	Het
Parp4	A	G	14: 56,866,661 (GRCm39)	D1075G	possibly damaging	Het
Pkp2	A	G	16: 16,086,546 (GRCm39)	I736V	probably benign	Het
Plekha8	T	C	6: 54,599,171 (GRCm39)	I235T	probably benign	Het
Polq	A	G	16: 36,880,701 (GRCm39)	D955G	probably benign	Het
Pramel16	A	G	4: 143,677,433 (GRCm39)	F49L	possibly damaging	Het
Psmd1	A	G	1: 86,061,459 (GRCm39)	K890E	probably damaging	Het
Rufy4	T	C	1: 74,186,822 (GRCm39)	C537R	probably damaging	Het
Scpep1	A	G	11: 88,821,070 (GRCm39)	Y366H	possibly damaging	Het
Slc18a3	A	G	14: 32,185,882 (GRCm39)	V167A	probably benign	Het
Sp8	A	G	12: 118,812,400 (GRCm39)	D85G	possibly damaging	Het
Stard3nl	G	A	13: 19,554,654 (GRCm39)	S144L	probably damaging	Het
Stk4	A	G	2: 163,930,879 (GRCm39)	E160G	possibly damaging	Het
Tbcb	T	C	7: 29,926,460 (GRCm39)	N119S	probably benign	Het
Tnc	G	T	4: 63,935,161 (GRCm39)	R592S	probably benign	Het
Trem3	T	A	17: 48,556,801 (GRCm39)	S91T	probably benign	Het
Trpc6	A	G	9: 8,610,267 (GRCm39)	E245G	probably benign	Het
Usp40	C	T	1: 87,880,083 (GRCm39)	R1036H	probably damaging	Het
Usp47	G	T	7: 111,654,139 (GRCm39)	G112C	probably damaging	Het
Wdr35	T	C	12: 9,024,149 (GRCm39)		probably benign	Het
Zc3h14	A	G	12: 98,746,456 (GRCm39)	K555R	probably benign	Het
Zfp26	T	C	9: 20,349,869 (GRCm39)	S232G	probably benign	Het
Zfp811	T	C	17: 33,017,432 (GRCm39)	T202A	probably benign	Het

Other mutations in Chd6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00837:Chd6	APN	2	160,883,999 (GRCm39)	missense	probably benign	0.01
IGL00899:Chd6	APN	2	160,871,218 (GRCm39)	splice site	probably benign
IGL01104:Chd6	APN	2	160,803,847 (GRCm39)	missense	probably damaging	1.00
IGL01295:Chd6	APN	2	160,830,290 (GRCm39)	splice site	probably benign
IGL01717:Chd6	APN	2	160,807,179 (GRCm39)	missense	possibly damaging	0.96
IGL01795:Chd6	APN	2	160,803,294 (GRCm39)	missense	probably benign	0.00
IGL01814:Chd6	APN	2	160,901,849 (GRCm39)	missense	probably benign	0.25
IGL02016:Chd6	APN	2	160,825,598 (GRCm39)	missense	probably damaging	1.00
IGL02104:Chd6	APN	2	160,819,432 (GRCm39)	missense	probably benign
IGL02158:Chd6	APN	2	160,868,212 (GRCm39)	missense	possibly damaging	0.73
IGL02313:Chd6	APN	2	160,807,595 (GRCm39)	missense	probably damaging	1.00
IGL02472:Chd6	APN	2	160,826,372 (GRCm39)	splice site	probably benign
IGL02522:Chd6	APN	2	160,807,716 (GRCm39)	missense	probably benign	0.30
IGL02626:Chd6	APN	2	160,881,270 (GRCm39)	splice site	probably benign
IGL02727:Chd6	APN	2	160,811,383 (GRCm39)	missense	probably damaging	0.96
IGL02738:Chd6	APN	2	160,807,618 (GRCm39)	missense	probably benign	0.45
IGL02743:Chd6	APN	2	160,802,183 (GRCm39)	missense	probably damaging	1.00
IGL02800:Chd6	APN	2	160,826,552 (GRCm39)	missense	probably damaging	1.00
IGL02811:Chd6	APN	2	160,832,221 (GRCm39)	missense	probably damaging	1.00
IGL02850:Chd6	APN	2	160,861,536 (GRCm39)	nonsense	probably null
IGL02979:Chd6	APN	2	160,808,090 (GRCm39)	missense	possibly damaging	0.48
IGL02993:Chd6	APN	2	160,894,304 (GRCm39)	splice site	probably benign
IGL03277:Chd6	APN	2	160,824,981 (GRCm39)	missense	probably null	1.00
IGL03346:Chd6	APN	2	160,802,282 (GRCm39)	missense	probably benign	0.00
IGL03357:Chd6	APN	2	160,859,936 (GRCm39)	splice site	probably benign
IGL03134:Chd6	UTSW	2	160,807,403 (GRCm39)	missense	possibly damaging	0.88
R0106:Chd6	UTSW	2	160,809,822 (GRCm39)	missense	probably damaging	1.00
R0106:Chd6	UTSW	2	160,809,822 (GRCm39)	missense	probably damaging	1.00
R0212:Chd6	UTSW	2	160,894,767 (GRCm39)	missense	probably damaging	0.99
R0363:Chd6	UTSW	2	160,856,244 (GRCm39)	missense	probably damaging	1.00
R0399:Chd6	UTSW	2	160,894,608 (GRCm39)	missense	probably damaging	1.00
R0511:Chd6	UTSW	2	160,834,111 (GRCm39)	missense	probably damaging	0.99
R0771:Chd6	UTSW	2	160,861,500 (GRCm39)	missense	probably damaging	1.00
R1147:Chd6	UTSW	2	160,832,191 (GRCm39)	missense	probably damaging	1.00
R1147:Chd6	UTSW	2	160,832,191 (GRCm39)	missense	probably damaging	1.00
R1184:Chd6	UTSW	2	160,872,722 (GRCm39)	missense	probably damaging	1.00
R1277:Chd6	UTSW	2	160,809,735 (GRCm39)	missense	probably damaging	1.00
R1396:Chd6	UTSW	2	160,825,023 (GRCm39)	missense	probably damaging	1.00
R1647:Chd6	UTSW	2	160,883,978 (GRCm39)	missense	probably damaging	1.00
R1648:Chd6	UTSW	2	160,883,978 (GRCm39)	missense	probably damaging	1.00
R1745:Chd6	UTSW	2	160,823,587 (GRCm39)	missense	probably damaging	0.96
R1766:Chd6	UTSW	2	160,808,559 (GRCm39)	missense	probably damaging	1.00
R1871:Chd6	UTSW	2	160,832,176 (GRCm39)	missense	probably damaging	1.00
R1928:Chd6	UTSW	2	160,809,920 (GRCm39)	splice site	probably benign
R1973:Chd6	UTSW	2	160,808,307 (GRCm39)	missense	probably damaging	0.99
R2200:Chd6	UTSW	2	160,825,673 (GRCm39)	missense	probably damaging	1.00
R2340:Chd6	UTSW	2	160,807,679 (GRCm39)	frame shift	probably null
R2341:Chd6	UTSW	2	160,807,679 (GRCm39)	frame shift	probably null
R2519:Chd6	UTSW	2	160,871,796 (GRCm39)	missense	possibly damaging	0.66
R2919:Chd6	UTSW	2	160,809,800 (GRCm39)	missense	possibly damaging	0.89
R3025:Chd6	UTSW	2	160,808,472 (GRCm39)	small deletion	probably benign
R3426:Chd6	UTSW	2	160,832,175 (GRCm39)	missense	probably damaging	1.00
R3427:Chd6	UTSW	2	160,832,175 (GRCm39)	missense	probably damaging	1.00
R4042:Chd6	UTSW	2	160,830,253 (GRCm39)	missense	probably damaging	1.00
R4273:Chd6	UTSW	2	160,803,211 (GRCm39)	missense	probably benign	0.04
R4399:Chd6	UTSW	2	160,807,238 (GRCm39)	missense	probably benign
R4458:Chd6	UTSW	2	160,871,796 (GRCm39)	missense	possibly damaging	0.66
R4583:Chd6	UTSW	2	160,856,114 (GRCm39)	missense	probably damaging	1.00
R4625:Chd6	UTSW	2	160,811,412 (GRCm39)	missense	probably damaging	1.00
R4740:Chd6	UTSW	2	160,812,103 (GRCm39)	missense	probably benign
R4765:Chd6	UTSW	2	160,808,164 (GRCm39)	nonsense	probably null
R4779:Chd6	UTSW	2	160,791,477 (GRCm39)	missense	probably damaging	1.00
R4877:Chd6	UTSW	2	160,871,219 (GRCm39)	splice site	probably benign
R5068:Chd6	UTSW	2	160,808,289 (GRCm39)	missense	possibly damaging	0.54
R5215:Chd6	UTSW	2	160,791,873 (GRCm39)	missense	probably damaging	1.00
R5275:Chd6	UTSW	2	160,811,283 (GRCm39)	missense	probably benign
R5405:Chd6	UTSW	2	160,807,310 (GRCm39)	missense	probably benign
R5598:Chd6	UTSW	2	160,856,032 (GRCm39)	missense	probably damaging	1.00
R5693:Chd6	UTSW	2	160,807,185 (GRCm39)	missense	probably benign
R5697:Chd6	UTSW	2	160,859,971 (GRCm39)	missense	probably damaging	1.00
R5715:Chd6	UTSW	2	160,791,798 (GRCm39)	missense	probably benign	0.00
R5759:Chd6	UTSW	2	160,825,682 (GRCm39)	missense	possibly damaging	0.91
R5761:Chd6	UTSW	2	160,798,999 (GRCm39)	missense	probably damaging	1.00
R5761:Chd6	UTSW	2	160,798,998 (GRCm39)	missense	probably damaging	1.00
R5954:Chd6	UTSW	2	160,807,747 (GRCm39)	missense	probably benign	0.00
R6025:Chd6	UTSW	2	160,807,502 (GRCm39)	missense	probably benign
R6104:Chd6	UTSW	2	160,856,052 (GRCm39)	missense	probably damaging	1.00
R6247:Chd6	UTSW	2	160,791,968 (GRCm39)	missense	probably damaging	1.00
R6393:Chd6	UTSW	2	160,821,407 (GRCm39)	missense	probably damaging	1.00
R6452:Chd6	UTSW	2	160,807,418 (GRCm39)	missense	possibly damaging	0.76
R6468:Chd6	UTSW	2	160,854,987 (GRCm39)	missense	probably damaging	1.00
R6784:Chd6	UTSW	2	160,808,174 (GRCm39)	missense	probably damaging	1.00
R6803:Chd6	UTSW	2	160,802,279 (GRCm39)	missense	possibly damaging	0.64
R6869:Chd6	UTSW	2	160,807,650 (GRCm39)	missense	probably benign
R6895:Chd6	UTSW	2	160,830,260 (GRCm39)	missense	probably damaging	1.00
R6925:Chd6	UTSW	2	160,855,047 (GRCm39)	missense	probably damaging	0.98
R7061:Chd6	UTSW	2	160,867,885 (GRCm39)	nonsense	probably null
R7064:Chd6	UTSW	2	160,791,983 (GRCm39)	missense	probably damaging	1.00
R7248:Chd6	UTSW	2	160,803,199 (GRCm39)	nonsense	probably null
R7287:Chd6	UTSW	2	160,850,312 (GRCm39)	missense	probably benign	0.07
R7431:Chd6	UTSW	2	160,868,248 (GRCm39)	missense	possibly damaging	0.92
R7486:Chd6	UTSW	2	160,791,923 (GRCm39)	missense	probably damaging	1.00
R7509:Chd6	UTSW	2	160,855,074 (GRCm39)	missense	probably damaging	1.00
R7699:Chd6	UTSW	2	160,867,863 (GRCm39)	missense	probably benign	0.13
R7748:Chd6	UTSW	2	160,808,539 (GRCm39)	missense	probably benign	0.37
R7785:Chd6	UTSW	2	160,812,095 (GRCm39)	missense	possibly damaging	0.51
R8002:Chd6	UTSW	2	160,832,241 (GRCm39)	missense	probably damaging	1.00
R8261:Chd6	UTSW	2	160,799,002 (GRCm39)	missense	probably damaging	1.00
R8317:Chd6	UTSW	2	160,832,241 (GRCm39)	missense	probably damaging	1.00
R8388:Chd6	UTSW	2	160,861,571 (GRCm39)	missense	probably damaging	1.00
R8865:Chd6	UTSW	2	160,862,989 (GRCm39)	missense	probably benign	0.10
R8867:Chd6	UTSW	2	160,862,989 (GRCm39)	missense	probably benign	0.10
R8996:Chd6	UTSW	2	160,823,543 (GRCm39)	missense	probably damaging	1.00
R9091:Chd6	UTSW	2	160,871,793 (GRCm39)	nonsense	probably null
R9270:Chd6	UTSW	2	160,871,793 (GRCm39)	nonsense	probably null
R9310:Chd6	UTSW	2	160,881,181 (GRCm39)	missense	probably damaging	1.00
R9367:Chd6	UTSW	2	160,871,784 (GRCm39)	missense	possibly damaging	0.83
R9438:Chd6	UTSW	2	160,799,078 (GRCm39)	missense	probably benign	0.01
R9756:Chd6	UTSW	2	160,802,259 (GRCm39)	missense	probably benign
Z1088:Chd6	UTSW	2	160,808,408 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCAGAAAACGGACTAGGGCC -3'
(R):5'- TCTCCTTCTGGAATGGGACC -3'

Sequencing Primer
(F):5'- CAGGCTTGTCGTCTACCAGAG -3'
(R):5'- ACCACTGTTCATGAATGGGC -3'

Posted On

2015-07-06