Incidental Mutation 'R4392:Bub3'
ID326413
Institutional Source Beutler Lab
Gene Symbol Bub3
Ensembl Gene ENSMUSG00000066979
Gene NameBUB3 mitotic checkpoint protein
Synonyms
MMRRC Submission 041127-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4392 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location131560222-131571895 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 131566335 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 187 (A187V)
Ref Sequence ENSEMBL: ENSMUSP00000081547 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084502] [ENSMUST00000124096] [ENSMUST00000207231] [ENSMUST00000207442] [ENSMUST00000207736] [ENSMUST00000208571]
Predicted Effect probably benign
Transcript: ENSMUST00000084502
AA Change: A187V

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000081547
Gene: ENSMUSG00000066979
AA Change: A187V

DomainStartEndE-ValueType
WD40 2 43 5.69e-4 SMART
WD40 46 83 8.91e-1 SMART
WD40 88 124 5.1e-6 SMART
WD40 127 163 6.16e0 SMART
WD40 214 262 4.02e-4 SMART
WD40 265 302 1.97e2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000124096
SMART Domains Protein: ENSMUSP00000130971
Gene: ENSMUSG00000030849

DomainStartEndE-ValueType
Pfam:Pkinase 1 118 4.8e-19 PFAM
Pfam:Pkinase_Tyr 1 118 1.7e-50 PFAM
low complexity region 146 160 N/A INTRINSIC
Predicted Effect silent
Transcript: ENSMUST00000207231
Predicted Effect probably benign
Transcript: ENSMUST00000207442
AA Change: A187V

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
Predicted Effect probably benign
Transcript: ENSMUST00000207736
Predicted Effect probably benign
Transcript: ENSMUST00000208571
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208848
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209131
Meta Mutation Damage Score 0.108 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.5%
  • 10x: 96.1%
  • 20x: 90.5%
Validation Efficiency 95% (69/73)
MGI Phenotype FUNCTION: This gene encodes a component of the mitotic spindle assembly complex. The encoded protein is involved in the regulation of chromosome segregation during oocyte meiosis. Disruption of this gene results in the accumulation of mitotic errors and is lethal in the embryonic stage. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2015]
PHENOTYPE: Homozygous mutation of this gene results in embryonic lethality by E8.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931414P19Rik C T 14: 54,584,978 probably null Het
Abca13 A C 11: 9,309,034 K2920T possibly damaging Het
Amy2b T G 3: 113,149,408 noncoding transcript Het
Anapc1 T C 2: 128,676,249 probably null Het
Bmp7 T G 2: 172,916,542 D178A probably benign Het
Brsk1 T A 7: 4,698,750 I170N probably damaging Het
Cacna2d2 A G 9: 107,400,280 H71R possibly damaging Het
Cdrt4 A T 11: 62,951,353 K20N probably benign Het
Clec12a A T 6: 129,353,464 probably benign Het
Col12a1 T A 9: 79,662,488 Y1600F probably damaging Het
Cyp2a12 T A 7: 27,029,275 I57N probably damaging Het
Dip2b T C 15: 100,162,036 L223P probably damaging Het
Dnah5 G A 15: 28,289,229 R1188H probably benign Het
Dopey1 T C 9: 86,503,143 probably benign Het
Efcab5 T A 11: 77,090,458 N1354I probably damaging Het
Eif4b T A 15: 102,086,641 probably null Het
Elmsan1 A T 12: 84,173,111 D356E probably benign Het
Erlec1 A G 11: 30,943,697 probably null Het
Esp24 T C 17: 39,040,077 probably benign Het
Esp34 T C 17: 38,559,491 V24A possibly damaging Het
Fbxw15 T A 9: 109,568,232 probably benign Het
Foxc2 T C 8: 121,117,452 S280P probably damaging Het
Gm21738 G C 14: 19,417,178 L117V probably benign Het
Grk3 A G 5: 112,920,136 F467S probably damaging Het
Grwd1 C T 7: 45,827,780 G228S probably damaging Het
Gtf2i T C 5: 134,260,629 E399G probably damaging Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Homer3 G A 8: 70,290,143 probably null Het
Lhx4 A G 1: 155,710,134 Y83H probably damaging Het
Mdga1 T C 17: 29,850,656 T413A probably damaging Het
Mmrn2 T A 14: 34,397,616 L184H probably damaging Het
Mroh2a C T 1: 88,259,589 R133C probably damaging Het
Myh13 A C 11: 67,344,881 probably null Het
Nkain3 C A 4: 20,282,985 R116L possibly damaging Het
Nxph2 A C 2: 23,400,272 Q212P probably damaging Het
Olfr268-ps1 T C 2: 111,844,345 noncoding transcript Het
Olfr726 A G 14: 50,084,603 F26S probably benign Het
Otog T C 7: 46,285,124 Y1369H probably damaging Het
Prl A G 13: 27,064,351 I131V possibly damaging Het
Ptprg A T 14: 12,142,467 I373F possibly damaging Het
Rad18 A T 6: 112,693,529 C25S probably damaging Het
Rgs12 A G 5: 35,032,311 T678A probably damaging Het
Scaper T A 9: 55,858,115 E557V probably damaging Het
Scube3 C T 17: 28,164,788 P511L probably null Het
Sgpl1 A G 10: 61,104,452 probably benign Het
Slc10a1 C A 12: 80,967,804 E47D probably damaging Het
Sptbn4 T C 7: 27,418,471 N369S probably damaging Het
Sstr5 T C 17: 25,491,224 T344A probably benign Het
Tgm4 C T 9: 123,066,752 T631I probably benign Het
Tmprss15 A G 16: 79,024,438 Y457H probably damaging Het
Trpm7 A T 2: 126,795,509 probably null Het
Trpm7 A T 2: 126,848,538 W207R probably damaging Het
Ttc26 A G 6: 38,381,557 probably benign Het
Ugt1a1 CAGAGAGAGAGAGA CAGAGAGAGAGA 1: 88,211,984 probably benign Het
Ugt1a10 C T 1: 88,215,123 P113L probably damaging Het
Usp2 A T 9: 44,091,259 H384L probably damaging Het
Vmn2r27 C T 6: 124,230,176 V169I probably benign Het
Vopp1 A C 6: 57,762,476 F29C probably damaging Het
Wrn T C 8: 33,251,832 D953G probably damaging Het
Zfp759 T A 13: 67,139,643 C419* probably null Het
Other mutations in Bub3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01813:Bub3 APN 7 131568633 missense probably benign 0.34
R0294:Bub3 UTSW 7 131568224 missense possibly damaging 0.83
R1591:Bub3 UTSW 7 131561608 critical splice donor site probably null
R2679:Bub3 UTSW 7 131568725 unclassified probably null
R2847:Bub3 UTSW 7 131570884 missense possibly damaging 0.79
R4856:Bub3 UTSW 7 131561568 missense probably damaging 1.00
R4992:Bub3 UTSW 7 131560806 missense probably damaging 1.00
R5364:Bub3 UTSW 7 131560738 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- GGAGCAAATGTCATTTTCAGGAAG -3'
(R):5'- ACACTTGACCTCTGGAACAC -3'

Sequencing Primer
(F):5'- TGTCATTTTCAGGAAGTAGATGATG -3'
(R):5'- CCAACATCTTCCCTAAAATGTGG -3'
Posted On2015-07-06