Incidental Mutation 'R4418:Tap1'
ID326974
Institutional Source Beutler Lab
Gene Symbol Tap1
Ensembl Gene ENSMUSG00000037321
Gene Nametransporter 1, ATP-binding cassette, sub-family B (MDR/TAP)
SynonymsABC transporter, MHC, 1; ABC17; antigen peptide transporter (APT1); ATP-binding cassette, subfamily B, member 2 (Abcb2); ATP-binding cassette, sub-family B (MDR/TAP), member 2; ATP-binding cassette transporter, major histocompatibility complex, 1; ATP dependent transport protein family member; histocompatibility antigen modifier 1 (Ham-1, Ham1); MTP1; peptide supply factor 1 (PSF-1); peptide transporter PSF1; RING4; transporter 1, ABC; transporter 1, ATP-binding cassette, sub-family B; transporter, ABC, MHC, 1; transporter, ATP-binding cassette, major histocompatibility complex, 1; transporter associated with antigen processing 1 (Tap-1, TAP); Y3
MMRRC Submission 041139-MU
Accession Numbers

Genbank: NM_013683; MGI: 98483

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4418 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location34187553-34197225 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to A at 34188379 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000041633] [ENSMUST00000170086] [ENSMUST00000171321] [ENSMUST00000173831] [ENSMUST00000174576]
Predicted Effect probably damaging
Transcript: ENSMUST00000041633
AA Change: L167Q

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000039264
Gene: ENSMUSG00000037321
AA Change: L167Q

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
transmembrane domain 37 59 N/A INTRINSIC
transmembrane domain 66 88 N/A INTRINSIC
transmembrane domain 116 138 N/A INTRINSIC
Pfam:ABC_membrane 163 420 9.1e-55 PFAM
AAA 478 666 2.21e-18 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000114230
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166287
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166582
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166853
Predicted Effect noncoding transcript
Transcript: ENSMUST00000168351
Predicted Effect probably damaging
Transcript: ENSMUST00000170086
AA Change: L167Q

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000128401
Gene: ENSMUSG00000037321
AA Change: L167Q

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
transmembrane domain 37 59 N/A INTRINSIC
transmembrane domain 66 88 N/A INTRINSIC
transmembrane domain 116 138 N/A INTRINSIC
Pfam:ABC_membrane 163 434 5.8e-70 PFAM
AAA 506 694 2.21e-18 SMART
Predicted Effect probably null
Transcript: ENSMUST00000171148
SMART Domains Protein: ENSMUSP00000130189
Gene: ENSMUSG00000037321

DomainStartEndE-ValueType
Pfam:ABC_membrane 1 114 1.5e-24 PFAM
Pfam:ABC_tran 167 196 1e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000171321
Predicted Effect probably benign
Transcript: ENSMUST00000173831
SMART Domains Protein: ENSMUSP00000134120
Gene: ENSMUSG00000096727

DomainStartEndE-ValueType
Pfam:Proteasome 1 64 2.3e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000174576
SMART Domains Protein: ENSMUSP00000133499
Gene: ENSMUSG00000096727

DomainStartEndE-ValueType
Pfam:Proteasome 17 198 1.2e-45 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000178857
Predicted Effect noncoding transcript
Transcript: ENSMUST00000179593
Meta Mutation Damage Score 0.238 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 95% (72/76)
MGI Phenotype FUNCTION: The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the MDR/TAP subfamily. Members of the MDR/TAP subfamily are involved in multidrug resistance. This protein forms a heterodimer with Tap2 that transports short peptides from the cytosol into the endoplasmic reticulum lumen. Mutations in the human gene may be associated with ankylosing spondylitis, insulin-dependent diabetes mellitus, and celiac disease. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2009]
PHENOTYPE: Mice homozygous for targeted mutations that inactivate the gene are deficient in antigen presentation, surface class I antigens, and CD4-8+ T cells. [provided by MGI curators]
Allele List at MGI
All alleles(2) : Targeted, knock-out(2)
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610009O20Rik T C 18: 38,261,287 probably null Het
4930523C07Rik A G 1: 160,044,802 noncoding transcript Het
5430419D17Rik A T 7: 131,247,465 D899V possibly damaging Het
Acot12 A G 13: 91,784,405 T507A possibly damaging Het
Agap2 T G 10: 127,091,650 C1113W probably damaging Het
Ap3s1-ps2 A T 8: 94,405,293 noncoding transcript Het
B3gnt3 T C 8: 71,693,769 R39G probably benign Het
Bahd1 G A 2: 118,922,523 R757H probably damaging Het
Chad C T 11: 94,567,837 H271Y possibly damaging Het
Chil4 G A 3: 106,203,727 P284S possibly damaging Het
Col6a1 T A 10: 76,718,405 K323* probably null Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dclre1c T C 2: 3,452,935 F285S possibly damaging Het
Dctn2 T G 10: 127,278,365 M360R probably benign Het
Dgka A T 10: 128,728,094 L462Q probably damaging Het
Drg2 A C 11: 60,468,146 K364T probably damaging Het
Dync1li1 T A 9: 114,706,170 S167R probably damaging Het
Fam189a2 T C 19: 23,979,435 T365A probably benign Het
Fer A T 17: 64,029,291 D554V possibly damaging Het
Fignl2 A G 15: 101,053,949 S151P possibly damaging Het
Gbgt1 A G 2: 28,498,408 Y35C probably damaging Het
Gm6526 T A 14: 43,748,845 I79K probably damaging Het
Gm884 T C 11: 103,618,314 probably benign Het
Gpr6 T G 10: 41,070,608 N326T probably damaging Het
Hcn4 C T 9: 58,843,895 T268M probably benign Het
Hist1h2bc C T 13: 23,684,503 T91M probably damaging Het
Hnf4g A G 3: 3,648,094 M243V possibly damaging Het
Homer1 A G 13: 93,402,069 E314G probably damaging Het
Hs6st1 T C 1: 36,104,027 Y348H probably damaging Het
Ifitm6 A T 7: 141,016,071 I103N probably damaging Het
Ipo5 T G 14: 120,943,893 C944G possibly damaging Het
Kcnb1 C A 2: 167,105,675 E418* probably null Het
Kcnk2 G A 1: 189,256,727 R207C probably damaging Het
Kctd8 T C 5: 69,341,162 E47G probably damaging Het
Klhdc2 C T 12: 69,307,597 probably benign Het
Mgat1 A G 11: 49,261,245 Y185C probably damaging Het
Mmp25 T A 17: 23,644,070 R122S probably damaging Het
Mrpl39 C A 16: 84,725,124 probably null Het
Naip6 C T 13: 100,300,600 A472T probably benign Het
Nek1 T C 8: 61,106,864 F1007S probably damaging Het
Neto1 T C 18: 86,404,856 M146T probably benign Het
Opn1sw G A 6: 29,379,424 R45* probably null Het
Osbpl5 A T 7: 143,709,815 C98* probably null Het
Pcdhb7 C T 18: 37,343,482 A557V probably benign Het
Pecam1 A G 11: 106,695,922 F155L possibly damaging Het
Plxna2 C T 1: 194,749,317 S538F probably damaging Het
Pmfbp1 C A 8: 109,530,633 Q609K probably benign Het
Pnpo A T 11: 96,940,969 probably null Het
Ppp2cb G A 8: 33,617,049 R254Q probably benign Het
Qser1 A T 2: 104,789,421 S349T probably damaging Het
Rnf167 T A 11: 70,647,917 W17R probably damaging Het
Rpl21-ps4 A G 14: 11,227,879 noncoding transcript Het
Rxfp2 A T 5: 150,048,800 H158L probably benign Het
Ryr3 C T 2: 112,831,224 C1807Y probably damaging Het
Scaper T A 9: 55,838,180 E601D probably damaging Het
Secisbp2l A T 2: 125,752,915 C542S probably benign Het
Slc6a19 A G 13: 73,684,395 V393A possibly damaging Het
Stil A G 4: 115,009,377 N176S probably benign Het
Tcl1b3 A T 12: 105,193,585 Q105L probably damaging Het
Tmem206 T A 1: 191,348,432 V283E probably damaging Het
Trappc10 G T 10: 78,217,188 A251D probably damaging Het
Trim43a G T 9: 88,582,153 C39F probably damaging Het
Ttn A T 2: 76,889,481 probably benign Het
Vmn2r110 A T 17: 20,583,689 L208* probably null Het
Vmn2r88 G T 14: 51,418,081 L583F probably damaging Het
Wasf1 C T 10: 40,936,582 H456Y unknown Het
Zfp120 A G 2: 150,118,185 I73T possibly damaging Het
Zfp990 T C 4: 145,536,728 C99R possibly damaging Het
Other mutations in Tap1
AlleleSourceChrCoordTypePredicted EffectPPH Score
rose APN 17 34194940 missense probably damaging 1.00
IGL01294:Tap1 APN 17 34194045 critical splice donor site probably null
IGL01776:Tap1 APN 17 34193128 missense possibly damaging 0.82
IGL01787:Tap1 APN 17 34196604 missense probably benign 0.21
IGL02246:Tap1 APN 17 34193989 missense probably benign 0.01
IGL02996:Tap1 APN 17 34191396 missense probably damaging 1.00
IGL03278:Tap1 APN 17 34191483 missense probably damaging 1.00
joplin UTSW 17 34193258 missense probably damaging 1.00
rose2 UTSW 17 34194941 missense probably damaging 1.00
PIT4802001:Tap1 UTSW 17 34193191 missense probably damaging 1.00
R1566:Tap1 UTSW 17 34189546 missense probably benign 0.00
R1795:Tap1 UTSW 17 34194925 missense probably benign 0.21
R1837:Tap1 UTSW 17 34188109 missense possibly damaging 0.50
R1839:Tap1 UTSW 17 34188109 missense possibly damaging 0.50
R1892:Tap1 UTSW 17 34194941 missense probably damaging 1.00
R1893:Tap1 UTSW 17 34194941 missense probably damaging 1.00
R1952:Tap1 UTSW 17 34193507 missense probably damaging 1.00
R2163:Tap1 UTSW 17 34189473 unclassified probably null
R3744:Tap1 UTSW 17 34193612 missense probably damaging 1.00
R3883:Tap1 UTSW 17 34193258 missense probably damaging 1.00
R3975:Tap1 UTSW 17 34189567 unclassified probably benign
R4779:Tap1 UTSW 17 34193891 missense probably damaging 1.00
R4913:Tap1 UTSW 17 34193494 missense possibly damaging 0.94
R5715:Tap1 UTSW 17 34192894 nonsense probably null
R5838:Tap1 UTSW 17 34193305 nonsense probably null
R6248:Tap1 UTSW 17 34193177 missense probably damaging 0.99
R6710:Tap1 UTSW 17 34188109 missense possibly damaging 0.50
R6881:Tap1 UTSW 17 34188034 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AACAGTCGTCCAGATGCCTTC -3'
(R):5'- TGATGTGAAGTTCTGCTCCCAG -3'

Sequencing Primer
(F):5'- AGATGCCTTCGCTATCAGTTATG -3'
(R):5'- TCTGCTCCCAGAAGACCCTG -3'
Posted On2015-07-07