Incidental Mutation 'R4425:Cd163'
ID328100
Institutional Source Beutler Lab
Gene Symbol Cd163
Ensembl Gene ENSMUSG00000008845
Gene NameCD163 antigen
Synonyms
MMRRC Submission 041144-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4425 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location124304656-124330527 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 124327903 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 1080 (S1080P)
Ref Sequence ENSEMBL: ENSMUSP00000108160 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032234] [ENSMUST00000112541]
Predicted Effect possibly damaging
Transcript: ENSMUST00000032234
AA Change: S1080P

PolyPhen 2 Score 0.938 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000032234
Gene: ENSMUSG00000008845
AA Change: S1080P

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
SR 50 150 1.1e-52 SMART
SR 157 258 1.4e-55 SMART
SR 265 365 7.3e-60 SMART
SR 372 472 1.2e-35 SMART
SR 477 577 2.3e-41 SMART
SR 582 682 9.8e-39 SMART
SR 719 819 1.1e-60 SMART
SR 824 927 4e-24 SMART
SR 930 1030 2.3e-55 SMART
transmembrane domain 1046 1068 N/A INTRINSIC
low complexity region 1095 1107 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000112541
AA Change: S1080P

PolyPhen 2 Score 0.938 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000108160
Gene: ENSMUSG00000008845
AA Change: S1080P

DomainStartEndE-ValueType
signal peptide 1 36 N/A INTRINSIC
SR 50 150 2.26e-50 SMART
SR 157 258 3.11e-53 SMART
SR 265 365 1.54e-57 SMART
SR 372 472 2.64e-33 SMART
SR 477 577 5.03e-39 SMART
SR 582 682 2.09e-36 SMART
SR 719 819 2.38e-58 SMART
SR 824 927 8.93e-22 SMART
SR 930 1030 5.06e-53 SMART
transmembrane domain 1046 1068 N/A INTRINSIC
low complexity region 1095 1107 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203210
Meta Mutation Damage Score 0.056 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 98% (55/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the scavenger receptor cysteine-rich (SRCR) superfamily, and is exclusively expressed in monocytes and macrophages. It functions as an acute phase-regulated receptor involved in the clearance and endocytosis of hemoglobin/haptoglobin complexes by macrophages, and may thereby protect tissues from free hemoglobin-mediated oxidative damage. This protein may also function as an innate immune sensor for bacteria and inducer of local inflammation. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Aug 2011]
PHENOTYPE: After hindlimb ischemia, mice homozygous for a knock-out allele exhibit increased muscle satellite cell proliferation, and enhanced skeletal muscle regeneration not limited to the site of injury. Knock-out mice also exhibit increased eosinophilic airway inflammation in house dust mite-challenged. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc3 T C 11: 94,346,044 T1456A probably damaging Het
Acad11 T C 9: 104,073,645 F56S probably damaging Het
Adamts8 A G 9: 30,956,656 N592S possibly damaging Het
Amh A G 10: 80,806,921 D313G probably damaging Het
Ampd2 T C 3: 108,086,736 probably benign Het
Arap3 A G 18: 37,978,600 L1115P probably damaging Het
Arfgap1 C A 2: 180,981,076 D327E probably benign Het
Capns2 T A 8: 92,901,624 I47N possibly damaging Het
Ceacam10 A T 7: 24,781,008 Y68F possibly damaging Het
Cep44 G A 8: 56,538,617 P317S probably benign Het
Cfh A T 1: 140,100,875 Y688* probably null Het
Chrnb1 A T 11: 69,786,947 S326R probably damaging Het
Cngb1 C T 8: 95,299,716 V25M probably damaging Het
Cyp2c50 A T 19: 40,090,692 N160Y possibly damaging Het
Dalrd3 T C 9: 108,571,601 probably benign Het
Eef1d C A 15: 75,902,799 S253I possibly damaging Het
Efl1 G A 7: 82,763,283 C960Y probably damaging Het
Elmo1 C G 13: 20,600,212 Y646* probably null Het
Epb41l2 C A 10: 25,506,180 D701E possibly damaging Het
Fbxl4 T A 4: 22,422,699 probably null Het
Fhod1 T C 8: 105,337,351 probably benign Het
Gm21761 C A 13: 119,912,372 L127F probably damaging Het
Gm8741 G T 17: 35,336,086 noncoding transcript Het
Igkv10-95 A T 6: 68,680,622 I21F probably damaging Het
Il10rb C A 16: 91,407,715 N51K possibly damaging Het
Krt78 T C 15: 101,947,940 T479A probably benign Het
Lrig3 T C 10: 126,013,404 S998P probably benign Het
Lrrc8c T A 5: 105,607,889 M510K probably benign Het
Nfrkb G T 9: 31,399,962 C369F probably damaging Het
Nphp1 T C 2: 127,788,799 E19G possibly damaging Het
Olfr1307 T C 2: 111,945,189 H89R probably benign Het
Olfr713 A C 7: 107,036,491 E112A probably damaging Het
Ovol3 A T 7: 30,235,364 probably null Het
Ppp1r16b C T 2: 158,757,254 T382I probably benign Het
Rims2 T C 15: 39,437,924 probably null Het
Sh3rf3 T C 10: 59,083,576 V505A probably benign Het
Shkbp1 T C 7: 27,343,302 N570S probably benign Het
Slc35f4 C T 14: 49,318,850 V149I possibly damaging Het
Snx27 A G 3: 94,562,023 F4L probably benign Het
Syvn1 C T 19: 6,049,921 probably benign Het
Tagap1 G A 17: 6,956,112 S395L probably benign Het
Tek A G 4: 94,863,667 T1014A probably damaging Het
Top2a A G 11: 99,001,405 I1077T probably benign Het
Tpo T C 12: 30,104,016 Y230C probably damaging Het
Trav12-2 A G 14: 53,616,875 Q102R possibly damaging Het
Ttn G A 2: 76,903,086 probably benign Het
Vmn1r183 A T 7: 24,055,548 I259F probably benign Het
Vmn1r228 T C 17: 20,776,599 E219G probably damaging Het
Vsig8 G T 1: 172,563,147 G254V probably damaging Het
Vwa8 A G 14: 79,082,806 I1086V probably benign Het
Zfp423 G A 8: 87,782,973 H123Y probably damaging Het
Zfp811 A T 17: 32,797,547 C506* probably null Het
Other mutations in Cd163
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00232:Cd163 APN 6 124329101 splice site probably benign
IGL00755:Cd163 APN 6 124318657 missense possibly damaging 0.70
IGL01690:Cd163 APN 6 124307318 missense possibly damaging 0.89
IGL02101:Cd163 APN 6 124307287 nonsense probably null
IGL02733:Cd163 APN 6 124325341 missense probably damaging 1.00
IGL02801:Cd163 APN 6 124320529 missense probably benign 0.00
IGL02897:Cd163 APN 6 124325527 missense probably damaging 1.00
IGL03074:Cd163 APN 6 124317986 missense probably benign 0.00
IGL03283:Cd163 APN 6 124309199 missense possibly damaging 0.49
compass UTSW 6 124329086 makesense probably null
hottish UTSW 6 124309208 missense probably damaging 1.00
protractor UTSW 6 124311566 missense probably damaging 1.00
t-square UTSW 6 124325288 missense probably damaging 0.97
R0494:Cd163 UTSW 6 124311449 missense probably damaging 1.00
R0554:Cd163 UTSW 6 124312660 missense probably benign 0.03
R0622:Cd163 UTSW 6 124317352 missense probably damaging 1.00
R1004:Cd163 UTSW 6 124325347 missense probably damaging 1.00
R1061:Cd163 UTSW 6 124309169 missense probably benign 0.00
R1132:Cd163 UTSW 6 124309096 nonsense probably null
R1195:Cd163 UTSW 6 124325250 splice site probably benign
R1195:Cd163 UTSW 6 124325250 splice site probably benign
R1436:Cd163 UTSW 6 124327931 missense possibly damaging 0.47
R1463:Cd163 UTSW 6 124311447 missense probably damaging 1.00
R1532:Cd163 UTSW 6 124312730 missense possibly damaging 0.91
R1541:Cd163 UTSW 6 124327961 missense probably benign
R1654:Cd163 UTSW 6 124317581 missense probably damaging 1.00
R1717:Cd163 UTSW 6 124329588 utr 3 prime probably benign
R1744:Cd163 UTSW 6 124307028 missense possibly damaging 0.94
R2014:Cd163 UTSW 6 124325498 missense probably damaging 0.99
R2035:Cd163 UTSW 6 124320629 missense probably damaging 0.97
R2095:Cd163 UTSW 6 124317822 missense probably damaging 1.00
R2124:Cd163 UTSW 6 124318856 missense probably damaging 1.00
R2146:Cd163 UTSW 6 124309208 missense probably damaging 1.00
R2353:Cd163 UTSW 6 124319156 nonsense probably null
R3854:Cd163 UTSW 6 124311566 missense probably damaging 1.00
R4631:Cd163 UTSW 6 124329086 makesense probably null
R4647:Cd163 UTSW 6 124320621 missense probably damaging 1.00
R4713:Cd163 UTSW 6 124317618 critical splice donor site probably null
R4803:Cd163 UTSW 6 124312430 missense probably damaging 0.99
R4996:Cd163 UTSW 6 124319147 missense probably benign 0.00
R5022:Cd163 UTSW 6 124325288 missense probably damaging 0.97
R5023:Cd163 UTSW 6 124325288 missense probably damaging 0.97
R5032:Cd163 UTSW 6 124311669 missense probably damaging 1.00
R5057:Cd163 UTSW 6 124325288 missense probably damaging 0.97
R5121:Cd163 UTSW 6 124317989 missense probably damaging 1.00
R5436:Cd163 UTSW 6 124327964 missense probably benign
R5453:Cd163 UTSW 6 124312541 missense probably damaging 1.00
R5723:Cd163 UTSW 6 124319063 missense probably benign 0.00
R5929:Cd163 UTSW 6 124326609 critical splice donor site probably null
R5943:Cd163 UTSW 6 124329602 makesense probably null
R5964:Cd163 UTSW 6 124326572 missense probably benign 0.01
R5966:Cd163 UTSW 6 124320636 nonsense probably null
R6279:Cd163 UTSW 6 124317991 nonsense probably null
R6300:Cd163 UTSW 6 124317991 nonsense probably null
R6499:Cd163 UTSW 6 124304744 missense probably benign 0.00
R6602:Cd163 UTSW 6 124311635 missense probably damaging 1.00
R6708:Cd163 UTSW 6 124309208 missense probably damaging 1.00
R6767:Cd163 UTSW 6 124304779 missense possibly damaging 0.56
R6979:Cd163 UTSW 6 124317986 missense probably benign 0.00
R6993:Cd163 UTSW 6 124317714 missense probably damaging 1.00
R7345:Cd163 UTSW 6 124318938 missense possibly damaging 0.52
R7552:Cd163 UTSW 6 124307228 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- CACAGAGCAGTGTTGGCTTC -3'
(R):5'- TGTGAGACATTTATCCCGCCC -3'

Sequencing Primer
(F):5'- TGGTAGGAGAATGGGTCATTACATC -3'
(R):5'- TGTCCCATTACAAGGTTTTAGAAC -3'
Posted On2015-07-07