Incidental Mutation 'R4460:Ctr9'
ID330107
Institutional Source Beutler Lab
Gene Symbol Ctr9
Ensembl Gene ENSMUSG00000005609
Gene NameCTR9 homolog, Paf1/RNA polymerase II complex component
SynonymsTsbp, Tsp, Sh2bp1
MMRRC Submission 041719-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.974) question?
Stock #R4460 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location111028951-111056377 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 111046894 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 698 (I698V)
Ref Sequence ENSEMBL: ENSMUSP00000005749 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005749]
Predicted Effect probably benign
Transcript: ENSMUST00000005749
AA Change: I698V

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000005749
Gene: ENSMUSG00000005609
AA Change: I698V

DomainStartEndE-ValueType
TPR 163 196 2.26e-3 SMART
TPR 198 231 2e-4 SMART
low complexity region 232 241 N/A INTRINSIC
TPR 306 339 4.52e-3 SMART
TPR 341 374 1.39e-3 SMART
TPR 451 484 3.56e-1 SMART
TPR 497 530 7.34e-3 SMART
TPR 531 564 3.24e-4 SMART
Blast:TPR 565 598 2e-14 BLAST
TPR 681 714 9.03e-3 SMART
TPR 717 750 1.6e1 SMART
coiled coil region 828 889 N/A INTRINSIC
low complexity region 892 916 N/A INTRINSIC
low complexity region 923 928 N/A INTRINSIC
low complexity region 932 1002 N/A INTRINSIC
low complexity region 1005 1028 N/A INTRINSIC
low complexity region 1034 1050 N/A INTRINSIC
low complexity region 1072 1090 N/A INTRINSIC
low complexity region 1133 1159 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123681
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146558
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152019
Predicted Effect noncoding transcript
Transcript: ENSMUST00000157025
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a component of the PAF1 complex, which associates with RNA polymerase II and functions in transcriptional regulation and elongation. This complex also plays a role in the modification of histones. [provided by RefSeq, Oct 2016]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik C T 7: 28,152,856 T1268I probably benign Het
A830010M20Rik A G 5: 107,503,765 T687A possibly damaging Het
C030048H21Rik A G 2: 26,255,863 probably null Het
Cav1 A G 6: 17,306,472 D8G probably damaging Het
Celf6 G A 9: 59,603,044 R103H probably damaging Het
Cts6 G C 13: 61,195,458 I316M probably benign Het
Dnajc13 C A 9: 104,181,063 R1496L probably damaging Het
Dscam A G 16: 96,610,319 Y1786H probably damaging Het
Itga2 C G 13: 114,843,483 D1061H probably damaging Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Klhl26 T C 8: 70,451,544 Y538C probably damaging Het
Ltk A G 2: 119,755,613 probably null Het
Med20 T C 17: 47,618,917 V93A probably benign Het
Mmp9 G T 2: 164,949,038 K115N probably damaging Het
Mroh5 A T 15: 73,791,796 D339E probably damaging Het
Muc1 A T 3: 89,231,563 D493V probably damaging Het
Mx1 G T 16: 97,454,081 S113R probably damaging Het
Nlrp9c T A 7: 26,378,098 H698L probably damaging Het
Nol9 T G 4: 152,057,836 L641R probably damaging Het
Park2 A T 17: 12,061,646 D463V probably damaging Het
Pla2g4e T G 2: 120,186,382 H226P possibly damaging Het
Pou2f1 A G 1: 165,895,006 F337L probably damaging Het
Ptcd1 G T 5: 145,159,506 A259E probably benign Het
Ptov1 T C 7: 44,865,576 M204V probably benign Het
Rasal2 A G 1: 157,175,832 F419S possibly damaging Het
Rbbp8nl A G 2: 180,280,971 S210P probably benign Het
Rgmb C A 17: 15,807,626 R277L probably benign Het
Snx2 A G 18: 53,176,444 E22G probably benign Het
Snx30 A T 4: 59,885,022 R221* probably null Het
Tmem143 C T 7: 45,906,952 T97I probably damaging Het
Ttn A C 2: 76,814,647 F12955V probably damaging Het
Ubr2 C T 17: 46,945,045 probably null Het
Vmn1r203 T A 13: 22,524,682 M211K probably damaging Het
Vmn2r121 G A X: 124,128,584 P580S probably benign Het
Zfp804b A T 5: 6,771,481 D491E probably damaging Het
Other mutations in Ctr9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01603:Ctr9 APN 7 111049331 missense probably damaging 1.00
IGL02379:Ctr9 APN 7 111051519 missense probably damaging 0.99
IGL02451:Ctr9 APN 7 111043424 nonsense probably null
IGL03222:Ctr9 APN 7 111043050 missense probably benign 0.41
R0023:Ctr9 UTSW 7 111043947 missense possibly damaging 0.83
R0023:Ctr9 UTSW 7 111043947 missense possibly damaging 0.83
R0586:Ctr9 UTSW 7 111049498 splice site probably benign
R0761:Ctr9 UTSW 7 111046272 missense probably damaging 0.97
R0834:Ctr9 UTSW 7 111050952 missense probably benign 0.06
R1593:Ctr9 UTSW 7 111042853 missense possibly damaging 0.82
R1711:Ctr9 UTSW 7 111055663 missense unknown
R1828:Ctr9 UTSW 7 111043958 synonymous probably null
R1838:Ctr9 UTSW 7 111052303 missense possibly damaging 0.93
R2037:Ctr9 UTSW 7 111046807 missense probably benign 0.04
R2171:Ctr9 UTSW 7 111046910 missense possibly damaging 0.69
R2512:Ctr9 UTSW 7 111046871 missense probably damaging 1.00
R2850:Ctr9 UTSW 7 111053446 missense unknown
R2851:Ctr9 UTSW 7 111053446 missense unknown
R3124:Ctr9 UTSW 7 111053446 missense unknown
R4049:Ctr9 UTSW 7 111055543 missense unknown
R4280:Ctr9 UTSW 7 111046723 intron probably benign
R4350:Ctr9 UTSW 7 111049318 missense probably damaging 1.00
R4352:Ctr9 UTSW 7 111049318 missense probably damaging 1.00
R4740:Ctr9 UTSW 7 111035371 missense probably benign 0.31
R5039:Ctr9 UTSW 7 111042857 missense probably benign 0.28
R5216:Ctr9 UTSW 7 111045458 missense possibly damaging 0.68
R5647:Ctr9 UTSW 7 111055544 missense unknown
R5677:Ctr9 UTSW 7 111044002 missense probably benign 0.45
R6907:Ctr9 UTSW 7 111030242 missense probably damaging 1.00
Z1088:Ctr9 UTSW 7 111030224 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTTAGAGCAACAGTCAGGCCTC -3'
(R):5'- AAGTCAGTCAGAGGATCTGCC -3'

Sequencing Primer
(F):5'- AACAGTCAGGCCTCTTACTGTCAG -3'
(R):5'- CCGTGGAATTGCGGCTCATAG -3'
Posted On2015-07-21