Incidental Mutation 'R4704:Eng'
ID356263
Institutional Source Beutler Lab
Gene Symbol Eng
Ensembl Gene ENSMUSG00000026814
Gene Nameendoglin
SynonymsCD105, Endo
MMRRC Submission 041952-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4704 (G1)
Quality Score119
Status Validated
Chromosome2
Chromosomal Location32646595-32682669 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 32678912 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 484 (S484P)
Ref Sequence ENSEMBL: ENSMUSP00000108897 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000009705] [ENSMUST00000028148] [ENSMUST00000113272] [ENSMUST00000167841]
Predicted Effect probably benign
Transcript: ENSMUST00000009705
AA Change: S484P

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000009705
Gene: ENSMUSG00000026814
AA Change: S484P

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
low complexity region 336 346 N/A INTRINSIC
ZP 362 569 1.29e-2 SMART
transmembrane domain 587 609 N/A INTRINSIC
low complexity region 619 634 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000028148
SMART Domains Protein: ENSMUSP00000028148
Gene: ENSMUSG00000009566

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
SCOP:d1jbwa2 43 327 1e-59 SMART
PDB:1O5Z|A 99 389 2e-37 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000113272
AA Change: S484P

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000108897
Gene: ENSMUSG00000026814
AA Change: S484P

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
low complexity region 335 345 N/A INTRINSIC
ZP 361 568 1.29e-2 SMART
transmembrane domain 586 608 N/A INTRINSIC
low complexity region 618 633 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130164
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132327
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142186
Predicted Effect unknown
Transcript: ENSMUST00000156306
AA Change: S197P
SMART Domains Protein: ENSMUSP00000122186
Gene: ENSMUSG00000026814
AA Change: S197P

DomainStartEndE-ValueType
low complexity region 26 36 N/A INTRINSIC
ZP 52 283 1.23e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000167841
AA Change: S483P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000130585
Gene: ENSMUSG00000026814
AA Change: S483P

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
low complexity region 336 346 N/A INTRINSIC
ZP 362 569 1.29e-2 SMART
transmembrane domain 587 609 N/A INTRINSIC
low complexity region 616 625 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175536
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196848
Meta Mutation Damage Score 0.016 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency 97% (89/92)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a homodimeric transmembrane protein which is a major glycoprotein of the vascular endothelium. This protein is a component of the transforming growth factor beta receptor complex and it binds to the beta1 and beta3 peptides with high affinity. Mutations in this gene cause hereditary hemorrhagic telangiectasia, also known as Osler-Rendu-Weber syndrome 1, an autosomal dominant multisystemic vascular dysplasia. This gene may also be involved in preeclampsia and several types of cancer. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2013]
PHENOTYPE: Homozygotes for targeted null mutations show defective vascular development, extra-arterial hematopoiesis, cardiac defects and die by embryonic day 11.0. Heterozygotes develop hemorrhagic telangiectasia causing strokes, fatal hemorrhage and heart failure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310057M21Rik A T 7: 131,357,530 M147K probably damaging Het
Abca13 A G 11: 9,276,990 D582G possibly damaging Het
Abca2 T C 2: 25,443,412 L1683P probably damaging Het
Adam39 A G 8: 40,825,796 H408R probably benign Het
Adcy4 A G 14: 55,775,025 S554P possibly damaging Het
Ahnak T G 19: 9,012,258 probably benign Het
Ahnak T C 19: 9,013,181 I3943T probably damaging Het
Alkal2 T A 12: 30,887,196 S109R probably damaging Het
Apobec4 A G 1: 152,756,250 T10A probably benign Het
Arhgef40 A G 14: 52,002,310 N1327S probably damaging Het
Arpc3 A G 5: 122,400,408 M1V probably null Het
Ascc1 A G 10: 60,049,802 Y225C probably damaging Het
Ascc3 A G 10: 50,659,014 I668V probably benign Het
Bdnf T A 2: 109,723,692 M137K possibly damaging Het
C87977 A T 4: 144,208,592 I193N probably damaging Het
Cacna1b T C 2: 24,654,463 D1231G probably damaging Het
Cds2 T A 2: 132,300,602 Y239* probably null Het
Cpped1 G A 16: 11,885,629 probably benign Het
Ctu2 G A 8: 122,479,303 R261Q probably damaging Het
Cux1 A G 5: 136,249,201 V645A probably benign Het
Cyp4f13 A G 17: 32,925,735 C401R probably damaging Het
Dpt T G 1: 164,818,949 Y162* probably null Het
Ednra A G 8: 77,667,963 probably benign Het
Eepd1 A G 9: 25,482,826 T129A probably benign Het
Eif2s1 A G 12: 78,877,170 T134A probably benign Het
Eloa A G 4: 136,011,214 V145A probably benign Het
Enam T A 5: 88,503,791 L1053* probably null Het
Eogt A T 6: 97,113,852 V442E probably damaging Het
Fam185a C T 5: 21,480,473 probably benign Het
Gm4922 C T 10: 18,784,819 V52I probably benign Het
Gnao1 A G 8: 93,811,376 E14G probably benign Het
Gpr75 C A 11: 30,891,110 A5D probably benign Het
Hbq1b T A 11: 32,287,448 probably benign Het
Hdac7 G A 15: 97,796,216 T724M probably damaging Het
Ifi204 C A 1: 173,760,361 probably benign Het
Ift88 A G 14: 57,480,850 probably benign Het
Irak4 A G 15: 94,566,900 probably null Het
Kalrn T C 16: 34,203,957 D610G probably damaging Het
Kifc2 T C 15: 76,662,977 probably null Het
Kmt2c G A 5: 25,314,027 Q2362* probably null Het
Kntc1 G A 5: 123,811,433 E1956K probably damaging Het
Lama3 T C 18: 12,553,223 V2781A probably benign Het
Lipt2 A G 7: 100,160,327 E207G probably damaging Het
Mag A T 7: 30,909,173 L172Q probably damaging Het
Map1b A T 13: 99,430,475 C1913S unknown Het
Mical3 A G 6: 120,958,688 S1626P probably benign Het
Mslnl G T 17: 25,738,978 W65L possibly damaging Het
Muc20 G T 16: 32,779,074 A3332S possibly damaging Het
Nadk C A 4: 155,585,227 P157T probably benign Het
Nkx2-3 G A 19: 43,612,684 E62K probably damaging Het
Olfr791 T C 10: 129,526,302 L25P possibly damaging Het
Pclo A G 5: 14,676,480 probably benign Het
Pcna-ps2 T A 19: 9,283,422 V15E possibly damaging Het
Plekhg3 G T 12: 76,578,238 G1285W probably damaging Het
Procr A G 2: 155,754,338 S142G probably damaging Het
Ptpn3 A T 4: 57,270,119 N14K possibly damaging Het
Rin1 C A 19: 5,054,990 L693I probably damaging Het
Ripk4 C A 16: 97,746,004 E290* probably null Het
Rnf213 A G 11: 119,440,349 Y2128C probably damaging Het
Saal1 T C 7: 46,699,740 probably benign Het
Selplg T C 5: 113,819,033 D404G probably benign Het
Serpinf1 C A 11: 75,411,041 A263S probably damaging Het
Sgo2b A T 8: 63,927,790 D669E probably damaging Het
Slc30a9 T C 5: 67,342,273 probably benign Het
Sri A T 5: 8,062,430 probably null Het
Sspo G A 6: 48,498,704 C4918Y probably damaging Het
Szt2 A G 4: 118,393,829 Y361H probably damaging Het
Tbc1d12 T A 19: 38,901,337 W404R probably damaging Het
Tcf20 T C 15: 82,851,727 E1841G possibly damaging Het
Tep1 T C 14: 50,837,073 T1832A probably benign Het
Tmem132e G A 11: 82,443,531 A623T probably damaging Het
Tmem201 A T 4: 149,727,317 F357Y possibly damaging Het
Trappc13 T G 13: 104,166,821 probably benign Het
Trav6-5 C T 14: 53,491,426 Q47* probably null Het
Ubxn1 T A 19: 8,872,035 D47E probably benign Het
Vmn2r45 G T 7: 8,483,536 S251* probably null Het
Wnk1 A G 6: 119,965,744 L774S possibly damaging Het
Zfp189 T C 4: 49,530,081 S395P probably damaging Het
Other mutations in Eng
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01326:Eng APN 2 32672382 missense probably benign 0.03
IGL01432:Eng APN 2 32669532 missense possibly damaging 0.66
IGL02203:Eng APN 2 32671486 missense probably benign 0.35
IGL02330:Eng APN 2 32669569 splice site probably null
IGL02633:Eng APN 2 32673274 missense probably damaging 0.99
IGL02747:Eng APN 2 32672958 critical splice donor site probably null
R0008:Eng UTSW 2 32677680 missense probably damaging 0.97
R0149:Eng UTSW 2 32672385 critical splice donor site probably null
R0206:Eng UTSW 2 32678993 missense probably benign 0.15
R0208:Eng UTSW 2 32678993 missense probably benign 0.15
R0360:Eng UTSW 2 32679137 missense probably benign 0.27
R0364:Eng UTSW 2 32679137 missense probably benign 0.27
R1399:Eng UTSW 2 32673322 missense probably damaging 0.98
R1520:Eng UTSW 2 32672941 missense probably benign 0.41
R1752:Eng UTSW 2 32673392 missense probably benign
R2162:Eng UTSW 2 32679047 missense probably damaging 1.00
R2201:Eng UTSW 2 32673740 splice site probably benign
R2389:Eng UTSW 2 32657672 critical splice donor site probably null
R3021:Eng UTSW 2 32678568 missense probably damaging 1.00
R3428:Eng UTSW 2 32657533 missense probably damaging 0.97
R5024:Eng UTSW 2 32673392 missense probably benign 0.00
R5130:Eng UTSW 2 32681506 missense probably damaging 1.00
R5182:Eng UTSW 2 32672959 critical splice donor site probably null
R6270:Eng UTSW 2 32673643 missense probably benign 0.26
R6790:Eng UTSW 2 32669445 missense probably damaging 0.99
R6872:Eng UTSW 2 32673275 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCACTTTGGAATGTCACTCTGTC -3'
(R):5'- CAGAGCTAAGTTGCAACTGAGG -3'

Sequencing Primer
(F):5'- GGAATGTCACTCTGTCCTGCC -3'
(R):5'- CTAAGTTGCAACTGAGGGTGCC -3'
Posted On2015-10-21