Incidental Mutation 'R4792:Alox5'
ID368669
Institutional Source Beutler Lab
Gene Symbol Alox5
Ensembl Gene ENSMUSG00000025701
Gene Namearachidonate 5-lipoxygenase
Synonyms5LO, 5-LOX, 5LX
MMRRC Submission 042419-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.214) question?
Stock #R4792 (G1)
Quality Score161
Status Validated
Chromosome6
Chromosomal Location116410077-116461178 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 116461003 bp
ZygosityHeterozygous
Amino Acid Change Valine to Leucine at position 8 (V8L)
Ref Sequence ENSEMBL: ENSMUSP00000145367 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026795] [ENSMUST00000164547] [ENSMUST00000170186] [ENSMUST00000203722]
Predicted Effect possibly damaging
Transcript: ENSMUST00000026795
AA Change: V8L

PolyPhen 2 Score 0.556 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000026795
Gene: ENSMUSG00000025701
AA Change: V8L

DomainStartEndE-ValueType
LH2 2 115 3.41e-39 SMART
Pfam:Lipoxygenase 212 662 1.5e-79 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000164547
AA Change: V8L

PolyPhen 2 Score 0.556 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000130780
Gene: ENSMUSG00000025701
AA Change: V8L

DomainStartEndE-ValueType
LH2 2 115 3.41e-39 SMART
Pfam:Lipoxygenase 125 217 5.1e-12 PFAM
Pfam:Lipoxygenase 213 564 8.4e-133 PFAM
Pfam:Lipoxygenase 558 609 7.3e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167447
Predicted Effect possibly damaging
Transcript: ENSMUST00000170186
AA Change: V8L

PolyPhen 2 Score 0.908 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000130424
Gene: ENSMUSG00000025701
AA Change: V8L

DomainStartEndE-ValueType
LH2 2 115 3.41e-39 SMART
Pfam:Lipoxygenase 150 220 1.9e-13 PFAM
Pfam:Lipoxygenase 215 432 8.6e-79 PFAM
Pfam:Lipoxygenase 426 634 1e-73 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000203722
AA Change: V8L

PolyPhen 2 Score 0.943 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000145367
Gene: ENSMUSG00000025701
AA Change: V8L

DomainStartEndE-ValueType
LH2 2 115 2.2e-41 SMART
Pfam:Lipoxygenase 213 430 3e-35 PFAM
Meta Mutation Damage Score 0.34 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.3%
Validation Efficiency 97% (89/92)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the lipoxygenase gene family and plays a dual role in the synthesis of leukotrienes from arachidonic acid. The encoded protein, which is expressed specifically in bone marrow-derived cells, catalyzes the conversion of arachidonic acid to 5(S)-hydroperoxy-6-trans-8,11,14-cis-eicosatetraenoic acid, and further to the allylic epoxide 5(S)-trans-7,9-trans-11,14-cis-eicosatetrenoic acid (leukotriene A4). Leukotrienes are important mediators of a number of inflammatory and allergic conditions. Mutations in the promoter region of this gene lead to a diminished response to antileukotriene drugs used in the treatment of asthma and may also be associated with atherosclerosis and several cancers. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2012]
PHENOTYPE: Nullizygous mice show altered inflammatory responses. One null mutation causes resistance to lethal anaphylaxis, abnormal eicosanoid production and neutrophil recruitment while another leads to increased body fat, bone density, leptin and VLDL cholesterol levels and resistance to autoimmune uveitis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700016G14Rik A G 13: 24,746,507 probably benign Het
2310061N02Rik A G 16: 88,707,763 S49P possibly damaging Het
Abcb1a T C 5: 8,746,657 probably null Het
Adgb G A 10: 10,398,903 T770I probably damaging Het
Adgre4 A T 17: 55,791,491 T134S probably benign Het
Aldh1a1 A G 19: 20,619,985 N110S probably damaging Het
Ambra1 A G 2: 91,772,846 T392A possibly damaging Het
Apob A G 12: 8,008,051 I2145V probably benign Het
Arhgap39 A G 15: 76,741,517 Y196H possibly damaging Het
Carmil1 A G 13: 24,067,190 L439S probably damaging Het
Carmil1 A T 13: 24,141,676 S224T possibly damaging Het
Cfh G A 1: 140,100,823 Q706* probably null Het
Chd2 A C 7: 73,468,577 S1098A probably benign Het
Chrna5 A T 9: 55,004,701 I158F probably damaging Het
Col6a5 T C 9: 105,930,784 T1022A unknown Het
Cul7 T A 17: 46,657,050 Y423* probably null Het
Cyp2e1 T C 7: 140,773,675 Y342H probably benign Het
D630045J12Rik T C 6: 38,148,340 K1580E probably damaging Het
Dnah6 A G 6: 73,089,668 M2573T probably damaging Het
Edem1 T A 6: 108,828,746 probably benign Het
Erp29 C T 5: 121,447,174 E86K probably benign Het
Esrp2 C A 8: 106,132,509 R535L probably damaging Het
Gabrb2 C T 11: 42,529,503 probably benign Het
Gpat3 C T 5: 100,857,173 P58L probably benign Het
Herc1 T A 9: 66,495,984 V4395E possibly damaging Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Hmgb2 G A 8: 57,513,310 C106Y probably damaging Het
Hoxa10 T C 6: 52,232,501 probably benign Het
Hsd3b1 T A 3: 98,852,910 Y255F probably benign Het
Ick A G 9: 78,153,693 D207G probably damaging Het
Ighd T C 12: 113,416,199 K42E probably benign Het
Ighv1-26 T C 12: 114,788,571 Y51C possibly damaging Het
Ighv5-2 C T 12: 113,578,799 E19K possibly damaging Het
Ipo11 T C 13: 106,834,160 probably benign Het
Itk C T 11: 46,344,831 probably benign Het
Kat6a T A 8: 22,940,576 H1982Q unknown Het
Kdm4d C T 9: 14,463,390 V391I probably benign Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Lgr6 T A 1: 135,021,806 S229C probably benign Het
Lhx9 T A 1: 138,838,351 Y233F possibly damaging Het
Lmf1 G A 17: 25,654,471 V317M probably damaging Het
Mapk4 T C 18: 73,937,250 T191A probably damaging Het
Mrc2 G A 11: 105,348,431 probably null Het
Naglu C T 11: 101,071,106 T135M probably damaging Het
Nomo1 T A 7: 46,044,219 probably null Het
Nop56 T A 2: 130,277,864 V75E possibly damaging Het
Nr1i3 G A 1: 171,218,595 C283Y probably damaging Het
Olfr1269 T A 2: 90,118,830 Y256F possibly damaging Het
Olfr557 G A 7: 102,698,726 G163R probably damaging Het
Olfr768 T G 10: 129,093,620 Y118S probably damaging Het
Pcdhga2 A G 18: 37,669,399 S99G probably benign Het
Pcnx T A 12: 81,919,151 D697E probably damaging Het
Plxnb1 G A 9: 109,110,648 D1462N probably damaging Het
Pnn G T 12: 59,072,205 V525F possibly damaging Het
Prrc2a A T 17: 35,156,487 D1062E probably damaging Het
Prss35 T A 9: 86,755,669 V164E probably damaging Het
Psapl1 T C 5: 36,205,203 S380P probably benign Het
Rnf222 A T 11: 68,893,019 E137D probably damaging Het
Rsph10b A G 5: 143,937,317 T79A probably damaging Het
Sbf2 T C 7: 110,351,610 Q1164R probably damaging Het
Scn7a T C 2: 66,726,248 D331G probably damaging Het
Shtn1 G C 19: 59,050,873 R45G probably damaging Het
Sspo G A 6: 48,461,585 S1529N probably benign Het
St8sia3 T A 18: 64,265,563 V31E probably benign Het
Sult1b1 A T 5: 87,515,047 W265R probably damaging Het
Supt5 G T 7: 28,316,329 Q863K probably benign Het
Tbc1d31 A G 15: 57,940,728 R380G probably benign Het
Tdpoz1 T A 3: 93,670,538 D313V possibly damaging Het
Tmem260 CAGGGACCGGCATAG CAG 14: 48,511,994 probably benign Het
Tpx2 A T 2: 152,885,096 T428S probably damaging Het
Trip11 A T 12: 101,885,446 H786Q probably benign Het
Trpc6 A T 9: 8,626,614 M322L probably benign Het
Try10 T C 6: 41,355,452 V14A probably benign Het
Unc13d A T 11: 116,070,282 F416L probably damaging Het
Vmn2r75 A T 7: 86,163,170 M547K possibly damaging Het
Wdr78 T C 4: 103,072,684 K370R possibly damaging Het
Zbp1 A G 2: 173,209,213 F288S probably damaging Het
Zc3h11a T A 1: 133,640,698 Q71L probably damaging Het
Zfp40 G A 17: 23,177,034 T193I possibly damaging Het
Zfp607a T C 7: 27,878,653 Y383H probably benign Het
Zfp622 T A 15: 25,987,042 Y82* probably null Het
Zfp964 T C 8: 69,664,015 F422L probably benign Het
Other mutations in Alox5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00331:Alox5 APN 6 116415517 missense probably damaging 1.00
IGL00954:Alox5 APN 6 116454299 missense probably damaging 1.00
IGL01610:Alox5 APN 6 116413547 missense probably damaging 1.00
IGL02161:Alox5 APN 6 116423193 missense probably benign 0.31
IGL02653:Alox5 APN 6 116415477 missense probably benign 0.41
IGL02903:Alox5 APN 6 116420335 missense probably damaging 1.00
clanger UTSW 6 116414595 missense probably damaging 1.00
triangle UTSW 6 116427137 splice site probably null
R0265:Alox5 UTSW 6 116420362 missense probably benign 0.04
R0347:Alox5 UTSW 6 116413552 missense possibly damaging 0.88
R0543:Alox5 UTSW 6 116454317 critical splice acceptor site probably null
R0633:Alox5 UTSW 6 116420384 missense probably damaging 1.00
R0656:Alox5 UTSW 6 116423330 splice site probably benign
R1298:Alox5 UTSW 6 116427264 missense probably damaging 1.00
R1416:Alox5 UTSW 6 116423145 nonsense probably null
R1484:Alox5 UTSW 6 116454167 missense probably damaging 1.00
R1485:Alox5 UTSW 6 116424164 missense probably damaging 1.00
R1518:Alox5 UTSW 6 116413780 missense probably damaging 0.99
R1993:Alox5 UTSW 6 116415463 missense probably damaging 1.00
R2313:Alox5 UTSW 6 116413861 missense probably benign 0.00
R3125:Alox5 UTSW 6 116427137 splice site probably null
R4042:Alox5 UTSW 6 116461018 missense possibly damaging 0.95
R4092:Alox5 UTSW 6 116412674 intron probably benign
R4356:Alox5 UTSW 6 116420258 missense probably benign 0.05
R4367:Alox5 UTSW 6 116460963 missense possibly damaging 0.86
R4690:Alox5 UTSW 6 116423189 missense probably damaging 1.00
R4873:Alox5 UTSW 6 116413850 unclassified probably null
R4875:Alox5 UTSW 6 116413850 unclassified probably null
R5135:Alox5 UTSW 6 116413786 missense probably benign 0.00
R5242:Alox5 UTSW 6 116460966 missense probably damaging 0.97
R5343:Alox5 UTSW 6 116413507 missense possibly damaging 0.95
R5780:Alox5 UTSW 6 116420349 missense probably benign 0.10
R6348:Alox5 UTSW 6 116414595 missense probably damaging 1.00
R6724:Alox5 UTSW 6 116414548 missense probably damaging 1.00
R6769:Alox5 UTSW 6 116415184 intron probably null
R6954:Alox5 UTSW 6 116420280 nonsense probably null
R7102:Alox5 UTSW 6 116413468 missense probably benign 0.01
X0028:Alox5 UTSW 6 116424154 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGACAGTTCTCAGGTGCCTG -3'
(R):5'- TCAGAGATCACTGTCCCTCC -3'

Sequencing Primer
(F):5'- AGGTGCCTGCCTGTCCTG -3'
(R):5'- TCCAGTGCCACAGGAGAG -3'
Posted On2016-02-04