Incidental Mutation 'R4953:Atp1a2'
ID381351
Institutional Source Beutler Lab
Gene Symbol Atp1a2
Ensembl Gene ENSMUSG00000007097
Gene NameATPase, Na+/K+ transporting, alpha 2 polypeptide
SynonymsAtpa-3
MMRRC Submission 042550-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4953 (G1)
Quality Score220
Status Validated
Chromosome1
Chromosomal Location172271709-172298064 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) A to T at 172291442 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000134280 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085913] [ENSMUST00000097464] [ENSMUST00000139528]
Predicted Effect probably benign
Transcript: ENSMUST00000085913
SMART Domains Protein: ENSMUSP00000083077
Gene: ENSMUSG00000007097

DomainStartEndE-ValueType
low complexity region 22 36 N/A INTRINSIC
Cation_ATPase_N 40 114 5.28e-19 SMART
Pfam:E1-E2_ATPase 132 363 2.5e-59 PFAM
Pfam:Hydrolase 368 726 4.5e-19 PFAM
Pfam:HAD 371 723 3.2e-18 PFAM
Pfam:Cation_ATPase 424 518 1.9e-25 PFAM
Pfam:Cation_ATPase_C 796 1005 1.4e-45 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000097464
SMART Domains Protein: ENSMUSP00000095072
Gene: ENSMUSG00000007097

DomainStartEndE-ValueType
low complexity region 22 36 N/A INTRINSIC
Cation_ATPase_N 40 114 5.28e-19 SMART
Pfam:E1-E2_ATPase 133 364 1.9e-63 PFAM
Pfam:Hydrolase 368 726 2e-32 PFAM
Pfam:HAD 371 723 1.7e-15 PFAM
Pfam:Hydrolase_like2 424 518 1.3e-26 PFAM
Pfam:Cation_ATPase_C 796 947 3.2e-30 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131751
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137679
SMART Domains Protein: ENSMUSP00000117873
Gene: ENSMUSG00000007097

DomainStartEndE-ValueType
low complexity region 22 36 N/A INTRINSIC
Cation_ATPase_N 40 114 5.28e-19 SMART
Pfam:E1-E2_ATPase 133 364 1.2e-63 PFAM
Pfam:Hydrolase 368 613 8.5e-9 PFAM
Pfam:Hydrolase_like2 424 518 5.7e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000139528
SMART Domains Protein: ENSMUSP00000134280
Gene: ENSMUSG00000038034

DomainStartEndE-ValueType
IG_like 19 84 3.66e1 SMART
low complexity region 92 103 N/A INTRINSIC
IG 106 222 2.3e-3 SMART
IG 246 370 9.49e-5 SMART
IG 382 508 3.59e-5 SMART
transmembrane domain 515 537 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155363
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.0%
Validation Efficiency 97% (113/116)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the family of P-type cation transport ATPases, and to the subfamily of Na+/K+ -ATPases. Na+/K+ -ATPase is an integral membrane protein responsible for establishing and maintaining the electrochemical gradients of Na and K ions across the plasma membrane. These gradients are essential for osmoregulation, for sodium-coupled transport of a variety of organic and inorganic molecules, and for electrical excitability of nerve and muscle. This enzyme is composed of two subunits, a large catalytic subunit (alpha) and a smaller glycoprotein subunit (beta). The catalytic subunit of Na+/K+ -ATPase is encoded by multiple genes. This gene encodes an alpha 2 subunit. Mutations in this gene result in familial basilar or hemiplegic migraines, and in a rare syndrome known as alternating hemiplegia of childhood. [provided by RefSeq, Oct 2008]
PHENOTYPE: Homozygous mutants die immediately after birth from breathing failure, lack spontaneous respiratory rhythm activity, have elevated levels of extracellular GABA in the brain, and have abnormal chloride homeostasis in brainstem neurons. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 97 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad9 T C 3: 36,074,376 Y129H probably damaging Het
Adcy4 C T 14: 55,779,029 D322N probably damaging Het
Adgre1 G A 17: 57,441,321 G507E probably damaging Het
Agpat5 G A 8: 18,868,955 V118I probably benign Het
Aif1 T C 17: 35,171,098 probably null Het
Akr1c6 A T 13: 4,438,609 probably null Het
Akt2 T A 7: 27,638,172 probably null Het
Ankrd35 T A 3: 96,683,673 L425Q possibly damaging Het
Arhgap40 A G 2: 158,543,406 T520A possibly damaging Het
Arhgef28 T A 13: 97,929,554 D1597V possibly damaging Het
Aspm A G 1: 139,471,734 D1079G probably benign Het
Cage1 C A 13: 38,023,430 E252D possibly damaging Het
Ccdc185 A G 1: 182,749,017 S36P possibly damaging Het
Cd300a T C 11: 114,893,421 V85A probably damaging Het
Cd38 A C 5: 43,907,545 D235A possibly damaging Het
Cdcp1 T C 9: 123,180,023 K530R probably benign Het
Ceacam20 T A 7: 19,971,726 L214Q probably damaging Het
Cntn4 G A 6: 106,525,418 A379T probably benign Het
Col4a2 A T 8: 11,429,505 E796V probably benign Het
Copa A G 1: 172,082,886 probably benign Het
Cpa5 A G 6: 30,631,364 T426A possibly damaging Het
Csmd1 A G 8: 16,199,917 F1016L probably damaging Het
Cyb5r3 A T 15: 83,158,621 L290* probably null Het
Ddx42 A G 11: 106,242,940 T581A probably damaging Het
Deaf1 C T 7: 141,322,468 G221S probably damaging Het
Dnah6 A G 6: 73,188,383 S580P probably benign Het
Dock1 A G 7: 135,152,288 E1598G probably benign Het
Drg2 T C 11: 60,459,436 probably benign Het
Eif3f C A 7: 108,934,640 probably benign Het
Fam184a G T 10: 53,698,805 T236K probably benign Het
Gas7 C T 11: 67,660,050 T126M possibly damaging Het
Gckr T G 5: 31,308,264 F408C probably damaging Het
Gm17472 A G 6: 42,981,070 D91G probably damaging Het
Gm5117 G A 8: 31,738,580 noncoding transcript Het
Gsto1 T A 19: 47,855,320 I47N probably damaging Het
Hck C T 2: 153,134,677 P244S probably damaging Het
Hif3a T C 7: 17,050,565 T250A probably damaging Het
Hmcn1 A T 1: 150,876,360 probably benign Het
Impa1 G A 3: 10,315,280 S247F probably damaging Het
Ints14 G C 9: 64,982,058 R397P probably damaging Het
Iqgap1 T C 7: 80,723,776 probably null Het
Krt2 T C 15: 101,813,942 K436R probably damaging Het
Lama3 G A 18: 12,448,305 C607Y probably damaging Het
Loxl4 G T 19: 42,610,694 probably benign Het
Lrrc8d C T 5: 105,813,368 T548M probably damaging Het
Man1b1 T A 2: 25,338,184 D155E probably damaging Het
Mapk8ip2 C T 15: 89,457,228 P214L probably benign Het
Mast1 G A 8: 84,918,728 T696I probably damaging Het
Muc15 C T 2: 110,731,272 P18S probably damaging Het
Mybl2 T C 2: 163,080,796 S205P probably damaging Het
Mylk T C 16: 34,988,961 S1763P probably damaging Het
Nek10 T A 14: 14,860,986 L513M possibly damaging Het
Nfib A G 4: 82,353,571 M252T probably benign Het
Nid2 C A 14: 19,778,078 Y261* probably null Het
Nmd3 C T 3: 69,731,637 R187C possibly damaging Het
Nomo1 G T 7: 46,050,731 probably benign Het
Npy4r A G 14: 34,146,480 F284L probably damaging Het
Nt5dc2 T C 14: 31,138,921 V351A possibly damaging Het
Ofcc1 G A 13: 40,015,388 T841I probably damaging Het
Olfr1480 T A 19: 13,529,814 L91Q probably null Het
Olfr996 T A 2: 85,579,725 L162* probably null Het
Pcdhb12 T A 18: 37,436,156 D118E probably damaging Het
Pdcd11 C T 19: 47,127,965 T1518I probably benign Het
Pde6a T A 18: 61,231,362 C163* probably null Het
Pign A T 1: 105,644,502 W314R probably benign Het
Pip5k1b T A 19: 24,390,435 H76L probably damaging Het
Plcz1 T C 6: 140,028,551 N55S possibly damaging Het
Pou5f1 A T 17: 35,510,541 H350L possibly damaging Het
Rchy1 A T 5: 91,962,628 probably null Het
Ric8b A G 10: 84,958,082 T270A possibly damaging Het
Rprml A G 11: 103,649,818 E13G probably benign Het
Secisbp2 T A 13: 51,682,027 I719N probably damaging Het
Sergef C T 7: 46,633,835 R148H probably benign Het
Serpina6 T A 12: 103,651,962 probably null Het
Sirpb1b C A 3: 15,548,827 W65L probably damaging Het
Slc32a1 A T 2: 158,614,057 I211F possibly damaging Het
Slc5a9 C A 4: 111,891,744 probably null Het
Smarce1 A G 11: 99,215,151 V226A probably benign Het
Spata31d1b A T 13: 59,716,283 E415V probably damaging Het
Speg G A 1: 75,423,864 R2556H possibly damaging Het
Suclg2 A C 6: 95,566,436 V338G probably damaging Het
Tarbp1 T C 8: 126,447,445 E874G possibly damaging Het
Tex14 G T 11: 87,536,901 probably null Het
Trim36 T A 18: 46,196,178 D53V possibly damaging Het
Tsga10ip T A 19: 5,394,340 Y21F possibly damaging Het
Ttn C T 2: 76,789,945 V15849M probably damaging Het
Ube3b T C 5: 114,401,410 S421P probably benign Het
Unc5a A T 13: 54,999,870 M498L probably benign Het
Vipr2 A G 12: 116,144,256 I420M probably benign Het
Vmn1r179 T A 7: 23,929,090 H235Q probably damaging Het
Vps35 T A 8: 85,281,846 I267F probably damaging Het
Wdr26 G A 1: 181,197,651 R279W probably damaging Het
Xpo6 C A 7: 126,169,271 R88L probably damaging Het
Zdhhc1 CGGGGG CGGGGGG 8: 105,483,744 probably null Het
Zfp105 T A 9: 122,929,815 S184T probably benign Het
Zfp574 G A 7: 25,080,963 R470H probably damaging Het
Zswim9 T A 7: 13,269,558 H122L probably damaging Het
Other mutations in Atp1a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00484:Atp1a2 APN 1 172276002 missense probably damaging 1.00
IGL00954:Atp1a2 APN 1 172290634 missense probably damaging 1.00
IGL01083:Atp1a2 APN 1 172284619 missense probably benign
IGL01372:Atp1a2 APN 1 172278943 missense probably damaging 1.00
IGL01762:Atp1a2 APN 1 172284913 missense possibly damaging 0.89
IGL01896:Atp1a2 APN 1 172286011 missense probably damaging 1.00
IGL01942:Atp1a2 APN 1 172286309 missense probably benign 0.35
IGL01944:Atp1a2 APN 1 172276187 missense probably damaging 0.98
IGL02219:Atp1a2 APN 1 172279718 missense probably damaging 1.00
IGL02219:Atp1a2 APN 1 172279731 nonsense probably null
IGL02304:Atp1a2 APN 1 172289353 missense probably benign
IGL02507:Atp1a2 APN 1 172285771 missense probably damaging 1.00
IGL02557:Atp1a2 APN 1 172278651 missense possibly damaging 0.83
IGL02632:Atp1a2 APN 1 172280614 missense possibly damaging 0.89
IGL03053:Atp1a2 APN 1 172278356 missense probably damaging 1.00
IGL03104:Atp1a2 APN 1 172293367 missense probably damaging 0.97
IGL03161:Atp1a2 APN 1 172278862 intron probably benign
IGL03218:Atp1a2 APN 1 172289303 missense probably null 0.82
PIT4151001:Atp1a2 UTSW 1 172290721 missense probably damaging 0.99
PIT4520001:Atp1a2 UTSW 1 172279374 missense probably benign 0.00
R0121:Atp1a2 UTSW 1 172289342 missense probably damaging 0.99
R0630:Atp1a2 UTSW 1 172291275 missense possibly damaging 0.78
R0682:Atp1a2 UTSW 1 172284597 missense probably benign 0.00
R0755:Atp1a2 UTSW 1 172289381 missense probably benign 0.37
R1413:Atp1a2 UTSW 1 172279344 missense probably damaging 1.00
R1680:Atp1a2 UTSW 1 172278954 missense probably damaging 0.99
R2094:Atp1a2 UTSW 1 172287433 missense probably damaging 1.00
R3714:Atp1a2 UTSW 1 172278984 missense probably damaging 0.96
R4573:Atp1a2 UTSW 1 172278637 missense possibly damaging 0.75
R4928:Atp1a2 UTSW 1 172278387 missense possibly damaging 0.93
R5014:Atp1a2 UTSW 1 172284871 missense probably benign 0.05
R5080:Atp1a2 UTSW 1 172284445 intron probably benign
R5129:Atp1a2 UTSW 1 172275955 missense probably benign 0.02
R5360:Atp1a2 UTSW 1 172278869 critical splice donor site probably null
R5619:Atp1a2 UTSW 1 172279381 missense probably damaging 0.99
R5622:Atp1a2 UTSW 1 172291427 intron probably benign
R5718:Atp1a2 UTSW 1 172279442 missense probably damaging 1.00
R5729:Atp1a2 UTSW 1 172293371 missense probably damaging 0.99
R5909:Atp1a2 UTSW 1 172287230 missense probably damaging 1.00
R6018:Atp1a2 UTSW 1 172298012 intron probably benign
R6145:Atp1a2 UTSW 1 172287238 missense probably damaging 1.00
R6164:Atp1a2 UTSW 1 172278892 missense probably damaging 0.97
R6315:Atp1a2 UTSW 1 172289336 missense probably damaging 0.99
R6317:Atp1a2 UTSW 1 172289336 missense probably damaging 0.99
R6319:Atp1a2 UTSW 1 172289336 missense probably damaging 0.99
R6323:Atp1a2 UTSW 1 172289336 missense probably damaging 0.99
R6324:Atp1a2 UTSW 1 172289336 missense probably damaging 0.99
R6374:Atp1a2 UTSW 1 172289375 missense probably damaging 1.00
R6764:Atp1a2 UTSW 1 172284614 missense probably benign
R6812:Atp1a2 UTSW 1 172284877 missense probably benign 0.20
R7025:Atp1a2 UTSW 1 172284550 nonsense probably null
R7194:Atp1a2 UTSW 1 172280627 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GGCCAGGATACCATAGGCTAAG -3'
(R):5'- CAAGAATAACCCAGGTGGAGCC -3'

Sequencing Primer
(F):5'- AGCAGAGGAGTGCCCCAATC -3'
(R):5'- GAGCCACAGTGAGTCCATATTAGC -3'
Posted On2016-04-27