Incidental Mutation 'R4999:Zc3h7b'
ID389767
Institutional Source Beutler Lab
Gene Symbol Zc3h7b
Ensembl Gene ENSMUSG00000022390
Gene Namezinc finger CCCH type containing 7B
SynonymsScrg3
MMRRC Submission 042593-MU
Accession Numbers

Genbank: NM_001081016; MGI: 1328310

Is this an essential gene? Possibly non essential (E-score: 0.323) question?
Stock #R4999 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location81745057-81796260 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 81779133 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 442 (Y442C)
Ref Sequence ENSEMBL: ENSMUSP00000105181 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109554]
Predicted Effect probably damaging
Transcript: ENSMUST00000109554
AA Change: Y442C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000105181
Gene: ENSMUSG00000022390
AA Change: Y442C

DomainStartEndE-ValueType
Pfam:TPR_11 34 113 2.3e-12 PFAM
Pfam:TPR_1 82 115 2.4e-6 PFAM
Pfam:TPR_8 82 115 8.2e-4 PFAM
Pfam:TPR_8 116 143 4.8e-3 PFAM
low complexity region 294 309 N/A INTRINSIC
low complexity region 340 354 N/A INTRINSIC
ZnF_C3H1 482 508 2.15e1 SMART
ZnF_C3H1 612 638 2.03e1 SMART
ZnF_C3H1 757 782 8.31e0 SMART
ZnF_C2H2 843 867 2.86e-1 SMART
ZnF_C3H1 889 914 7.81e-1 SMART
low complexity region 959 981 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229044
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230368
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230590
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231108
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 92.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that contains a tetratricopeptide repeat domain. The encoded protein also interacts with the rotavirus non-structural protein NSP3. [provided by RefSeq, Jul 2008]
Allele List at MGI

All alleles(9) : Gene trapped(9)

Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930444P10Rik A G 1: 16,068,798 probably null Het
Abca4 T A 3: 122,105,370 V667D probably damaging Het
Aco1 A G 4: 40,176,507 I224V probably damaging Het
Arel1 C T 12: 84,931,767 V364M probably damaging Het
Arhgap42 A G 9: 9,009,434 V484A probably damaging Het
Asap2 T C 12: 21,252,765 F681L probably benign Het
Atrn C A 2: 130,975,954 D809E probably damaging Het
BC037034 T A 5: 138,261,622 T391S probably damaging Het
Ccdc70 G A 8: 21,973,250 V19M possibly damaging Het
Ccp110 G T 7: 118,730,012 E73* probably null Het
Cfap57 A C 4: 118,595,848 S553A probably benign Het
Cftr A G 6: 18,221,614 K212E probably benign Het
Chkb A T 15: 89,428,165 Y216N probably damaging Het
Cntnap2 G T 6: 45,920,834 D149Y probably damaging Het
Cpd A G 11: 76,846,222 probably null Het
Creb3l1 C T 2: 91,983,226 D489N probably benign Het
Crhbp A G 13: 95,442,245 F123L probably damaging Het
Cryab T C 9: 50,754,609 V100A possibly damaging Het
Csmd2 T C 4: 128,521,930 I2684T probably benign Het
Ctbp2 G T 7: 133,014,649 P186T possibly damaging Het
Ctnna2 T C 6: 76,915,762 N814S possibly damaging Het
Dntt T C 19: 41,039,856 V197A probably damaging Het
Fam135a G A 1: 24,020,677 A1187V possibly damaging Het
Filip1l A T 16: 57,570,415 Q455H probably benign Het
Grm2 T C 9: 106,653,990 E100G probably damaging Het
Gtf2ird2 G A 5: 134,217,464 V855M probably damaging Het
Heatr9 A T 11: 83,518,792 I118N possibly damaging Het
Htra3 T C 5: 35,671,125 H137R probably benign Het
Iars A G 13: 49,709,661 S530G probably damaging Het
Klhdc4 T A 8: 121,796,603 M510L probably benign Het
Lipc T C 9: 70,816,731 T204A probably benign Het
Lrp1 A G 10: 127,553,779 V3129A probably damaging Het
Macf1 G A 4: 123,494,909 T1120I probably benign Het
Map4 T C 9: 110,038,377 probably benign Het
Mbtps1 A T 8: 119,533,348 V420D probably damaging Het
Mta2 G T 19: 8,950,383 D523Y probably benign Het
Muc4 A G 16: 32,756,296 probably benign Het
Mug1 C T 6: 121,878,943 Q965* probably null Het
Myo1e T A 9: 70,353,312 I584N probably damaging Het
Nolc1 T C 19: 46,078,920 V80A probably damaging Het
Nop56 G T 2: 130,275,725 V91L probably benign Het
Olfr1451 A T 19: 12,999,219 M78L probably benign Het
Olfr191 A T 16: 59,086,402 L27Q probably damaging Het
Olfr523 T C 7: 140,177,020 V300A probably damaging Het
Osbpl3 T C 6: 50,336,297 E107G probably damaging Het
Pde3a T A 6: 141,250,025 C146S probably benign Het
Pfkm A G 15: 98,128,242 M573V probably damaging Het
Pkd1l2 C T 8: 117,047,374 probably null Het
Plekhg3 T C 12: 76,565,247 I374T possibly damaging Het
Ppig T A 2: 69,741,486 V183D unknown Het
Prom1 T G 5: 44,037,534 I290L probably benign Het
Rufy3 T A 5: 88,637,226 M387K probably damaging Het
Selenoo G A 15: 89,094,184 R270H probably damaging Het
Sema3d T A 5: 12,508,087 probably null Het
Sema6c C T 3: 95,168,363 T175I probably damaging Het
Serpina3k T C 12: 104,341,046 I179T probably damaging Het
Sf3b3 T C 8: 110,841,203 T207A probably benign Het
Slc22a26 C A 19: 7,802,181 R90L probably damaging Het
Slitrk5 T C 14: 111,680,216 V424A probably damaging Het
Smarca2 G T 19: 26,720,855 E89* probably null Het
Soga1 C T 2: 157,022,856 G1144D probably benign Het
Stab2 T A 10: 86,937,909 S853C probably damaging Het
Stk17b A T 1: 53,761,147 probably null Het
Taar5 T A 10: 23,971,547 I281N possibly damaging Het
Tarsl2 A T 7: 65,658,935 E284D probably damaging Het
Tbx15 C A 3: 99,316,333 T279K probably damaging Het
Tfr2 G A 5: 137,586,925 V740I probably benign Het
Tlr12 T C 4: 128,617,680 E259G probably benign Het
Tmem145 A G 7: 25,309,034 T302A probably benign Het
Tmem57 A G 4: 134,828,133 I343T probably benign Het
Trpa1 G T 1: 14,875,861 H1015Q probably benign Het
Tspan8 A G 10: 115,817,629 Y10C possibly damaging Het
Ttll7 A G 3: 146,894,469 N44S probably damaging Het
Uba7 T C 9: 107,979,839 probably null Het
Ube2j2 G A 4: 155,946,384 M1I probably null Het
Ubr5 C A 15: 38,009,668 A1022S probably benign Het
Usf1 T G 1: 171,415,763 I36S probably damaging Het
Vmn1r181 A T 7: 23,984,365 D85V probably damaging Het
Vmn1r3 A T 4: 3,185,009 Y99* probably null Het
Vmn1r72 T C 7: 11,670,373 I49M possibly damaging Het
Vmn2r99 A G 17: 19,362,135 M1V probably null Het
Vsig10 T A 5: 117,343,975 V410E probably damaging Het
Zfyve26 G T 12: 79,280,385 Y730* probably null Het
Other mutations in Zc3h7b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01726:Zc3h7b APN 15 81771799 missense possibly damaging 0.95
IGL01955:Zc3h7b APN 15 81792004 missense probably benign 0.10
IGL02526:Zc3h7b APN 15 81793137 missense probably benign 0.10
IGL02582:Zc3h7b APN 15 81769140 missense probably benign 0.05
IGL02736:Zc3h7b APN 15 81791974 missense probably benign 0.02
F6893:Zc3h7b UTSW 15 81778671 missense possibly damaging 0.94
R0212:Zc3h7b UTSW 15 81776328 missense probably benign 0.00
R0242:Zc3h7b UTSW 15 81768830 splice site probably benign
R0471:Zc3h7b UTSW 15 81781968 missense probably damaging 1.00
R0590:Zc3h7b UTSW 15 81776998 missense possibly damaging 0.74
R1530:Zc3h7b UTSW 15 81777088 missense probably benign
R1563:Zc3h7b UTSW 15 81777088 missense probably benign
R1565:Zc3h7b UTSW 15 81777088 missense probably benign
R1566:Zc3h7b UTSW 15 81768834 missense possibly damaging 0.91
R1670:Zc3h7b UTSW 15 81777067 missense probably benign
R1712:Zc3h7b UTSW 15 81777088 missense probably benign
R1727:Zc3h7b UTSW 15 81768029 missense probably damaging 1.00
R2069:Zc3h7b UTSW 15 81792328 missense probably damaging 0.98
R2375:Zc3h7b UTSW 15 81792502 missense probably benign 0.17
R2656:Zc3h7b UTSW 15 81780430 missense probably damaging 1.00
R4660:Zc3h7b UTSW 15 81792250 missense probably benign 0.07
R4764:Zc3h7b UTSW 15 81769183 critical splice donor site probably null
R4815:Zc3h7b UTSW 15 81793663 missense probably damaging 1.00
R5086:Zc3h7b UTSW 15 81793174 missense probably damaging 0.96
R5169:Zc3h7b UTSW 15 81773314 missense probably benign 0.01
R5395:Zc3h7b UTSW 15 81772501 missense possibly damaging 0.50
R5407:Zc3h7b UTSW 15 81785891 missense probably damaging 0.99
R5587:Zc3h7b UTSW 15 81771858 missense possibly damaging 0.80
R5721:Zc3h7b UTSW 15 81773298 missense probably benign 0.02
R6001:Zc3h7b UTSW 15 81792035 missense possibly damaging 0.89
R6151:Zc3h7b UTSW 15 81778710 critical splice donor site probably null
R6248:Zc3h7b UTSW 15 81783185 missense probably damaging 1.00
R6397:Zc3h7b UTSW 15 81792854 missense probably benign 0.03
R6502:Zc3h7b UTSW 15 81769051 missense probably benign 0.01
R7248:Zc3h7b UTSW 15 81771787 missense possibly damaging 0.46
R7397:Zc3h7b UTSW 15 81769153 missense possibly damaging 0.50
R7450:Zc3h7b UTSW 15 81783080 missense probably benign
R7471:Zc3h7b UTSW 15 81780481 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GACTGTTAGGGAAGTCACGTGG -3'
(R):5'- CTATGGTCACTGCAGTAGGTC -3'

Sequencing Primer
(F):5'- GTCACGTGGTGGGAACG -3'
(R):5'- CACTGCAGTAGGTCTGGGAG -3'
Posted On2016-06-06