Incidental Mutation 'R4999:Klhdc4'
ID389744
Institutional Source Beutler Lab
Gene Symbol Klhdc4
Ensembl Gene ENSMUSG00000040263
Gene Namekelch domain containing 4
Synonyms
MMRRC Submission 042593-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.212) question?
Stock #R4999 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location121796313-121829569 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 121796603 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 510 (M510L)
Ref Sequence ENSEMBL: ENSMUSP00000134487 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045884] [ENSMUST00000127664] [ENSMUST00000167439] [ENSMUST00000174192] [ENSMUST00000174665] [ENSMUST00000174717]
Predicted Effect probably benign
Transcript: ENSMUST00000045884
AA Change: M567L

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000043439
Gene: ENSMUSG00000040263
AA Change: M567L

DomainStartEndE-ValueType
low complexity region 2 20 N/A INTRINSIC
low complexity region 22 34 N/A INTRINSIC
Pfam:Kelch_4 63 118 8.3e-11 PFAM
Pfam:Kelch_3 75 125 1.7e-9 PFAM
Pfam:Kelch_6 118 174 2.4e-9 PFAM
Pfam:Kelch_4 118 175 3e-8 PFAM
Pfam:Kelch_3 131 185 2e-8 PFAM
Pfam:Kelch_5 173 216 7.5e-9 PFAM
Pfam:Kelch_3 186 239 2.1e-6 PFAM
Pfam:Kelch_1 295 345 4.6e-6 PFAM
Pfam:Kelch_2 295 349 2.1e-7 PFAM
low complexity region 489 520 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000127664
SMART Domains Protein: ENSMUSP00000118564
Gene: ENSMUSG00000092329

DomainStartEndE-ValueType
Pfam:Glycos_transf_2 104 287 7.4e-31 PFAM
Pfam:Glyco_transf_7C 261 331 4.9e-8 PFAM
RICIN 406 531 9.28e-27 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000167439
SMART Domains Protein: ENSMUSP00000126190
Gene: ENSMUSG00000025318

DomainStartEndE-ValueType
MORN 13 34 8.01e-1 SMART
MORN 37 57 6.13e1 SMART
MORN 59 80 2.99e-1 SMART
Pfam:MORN 83 104 5.8e-2 PFAM
MORN 105 126 8.1e-5 SMART
MORN 128 149 2.74e-2 SMART
low complexity region 181 192 N/A INTRINSIC
low complexity region 212 244 N/A INTRINSIC
MORN 286 307 2.78e-3 SMART
MORN 309 330 1.03e-6 SMART
low complexity region 360 381 N/A INTRINSIC
low complexity region 393 409 N/A INTRINSIC
low complexity region 481 494 N/A INTRINSIC
transmembrane domain 721 743 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172507
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172954
Predicted Effect probably benign
Transcript: ENSMUST00000174192
AA Change: M510L

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000134487
Gene: ENSMUSG00000040263
AA Change: M510L

DomainStartEndE-ValueType
Pfam:Kelch_3 32 70 1.5e-6 PFAM
Pfam:Kelch_6 61 117 1.9e-8 PFAM
Pfam:Kelch_4 61 118 6.9e-8 PFAM
Pfam:Kelch_3 74 128 4.6e-8 PFAM
Pfam:Kelch_5 116 159 1.4e-7 PFAM
Pfam:Kelch_4 119 172 2.2e-6 PFAM
Pfam:Kelch_3 129 182 7e-7 PFAM
Pfam:Kelch_2 238 292 1.8e-7 PFAM
low complexity region 432 463 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174206
Predicted Effect probably benign
Transcript: ENSMUST00000174665
SMART Domains Protein: ENSMUSP00000134474
Gene: ENSMUSG00000040263

DomainStartEndE-ValueType
low complexity region 2 20 N/A INTRINSIC
low complexity region 22 34 N/A INTRINSIC
low complexity region 57 67 N/A INTRINSIC
low complexity region 104 114 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174709
Predicted Effect probably benign
Transcript: ENSMUST00000174717
AA Change: M536L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000134361
Gene: ENSMUSG00000040263
AA Change: M536L

DomainStartEndE-ValueType
low complexity region 2 20 N/A INTRINSIC
low complexity region 22 34 N/A INTRINSIC
Pfam:Kelch_4 63 117 1.4e-8 PFAM
Pfam:Kelch_3 75 127 9.6e-11 PFAM
Pfam:Kelch_4 118 170 2.3e-7 PFAM
Pfam:Kelch_6 118 174 9.3e-9 PFAM
low complexity region 191 202 N/A INTRINSIC
Pfam:Kelch_2 264 318 2e-7 PFAM
low complexity region 458 489 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 92.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930444P10Rik A G 1: 16,068,798 probably null Het
Abca4 T A 3: 122,105,370 V667D probably damaging Het
Aco1 A G 4: 40,176,507 I224V probably damaging Het
Arel1 C T 12: 84,931,767 V364M probably damaging Het
Arhgap42 A G 9: 9,009,434 V484A probably damaging Het
Asap2 T C 12: 21,252,765 F681L probably benign Het
Atrn C A 2: 130,975,954 D809E probably damaging Het
BC037034 T A 5: 138,261,622 T391S probably damaging Het
Ccdc70 G A 8: 21,973,250 V19M possibly damaging Het
Ccp110 G T 7: 118,730,012 E73* probably null Het
Cfap57 A C 4: 118,595,848 S553A probably benign Het
Cftr A G 6: 18,221,614 K212E probably benign Het
Chkb A T 15: 89,428,165 Y216N probably damaging Het
Cntnap2 G T 6: 45,920,834 D149Y probably damaging Het
Cpd A G 11: 76,846,222 probably null Het
Creb3l1 C T 2: 91,983,226 D489N probably benign Het
Crhbp A G 13: 95,442,245 F123L probably damaging Het
Cryab T C 9: 50,754,609 V100A possibly damaging Het
Csmd2 T C 4: 128,521,930 I2684T probably benign Het
Ctbp2 G T 7: 133,014,649 P186T possibly damaging Het
Ctnna2 T C 6: 76,915,762 N814S possibly damaging Het
Dntt T C 19: 41,039,856 V197A probably damaging Het
Fam135a G A 1: 24,020,677 A1187V possibly damaging Het
Filip1l A T 16: 57,570,415 Q455H probably benign Het
Grm2 T C 9: 106,653,990 E100G probably damaging Het
Gtf2ird2 G A 5: 134,217,464 V855M probably damaging Het
Heatr9 A T 11: 83,518,792 I118N possibly damaging Het
Htra3 T C 5: 35,671,125 H137R probably benign Het
Iars A G 13: 49,709,661 S530G probably damaging Het
Lipc T C 9: 70,816,731 T204A probably benign Het
Lrp1 A G 10: 127,553,779 V3129A probably damaging Het
Macf1 G A 4: 123,494,909 T1120I probably benign Het
Map4 T C 9: 110,038,377 probably benign Het
Mbtps1 A T 8: 119,533,348 V420D probably damaging Het
Mta2 G T 19: 8,950,383 D523Y probably benign Het
Muc4 A G 16: 32,756,296 probably benign Het
Mug1 C T 6: 121,878,943 Q965* probably null Het
Myo1e T A 9: 70,353,312 I584N probably damaging Het
Nolc1 T C 19: 46,078,920 V80A probably damaging Het
Nop56 G T 2: 130,275,725 V91L probably benign Het
Olfr1451 A T 19: 12,999,219 M78L probably benign Het
Olfr191 A T 16: 59,086,402 L27Q probably damaging Het
Olfr523 T C 7: 140,177,020 V300A probably damaging Het
Osbpl3 T C 6: 50,336,297 E107G probably damaging Het
Pde3a T A 6: 141,250,025 C146S probably benign Het
Pfkm A G 15: 98,128,242 M573V probably damaging Het
Pkd1l2 C T 8: 117,047,374 probably null Het
Plekhg3 T C 12: 76,565,247 I374T possibly damaging Het
Ppig T A 2: 69,741,486 V183D unknown Het
Prom1 T G 5: 44,037,534 I290L probably benign Het
Rufy3 T A 5: 88,637,226 M387K probably damaging Het
Selenoo G A 15: 89,094,184 R270H probably damaging Het
Sema3d T A 5: 12,508,087 probably null Het
Sema6c C T 3: 95,168,363 T175I probably damaging Het
Serpina3k T C 12: 104,341,046 I179T probably damaging Het
Sf3b3 T C 8: 110,841,203 T207A probably benign Het
Slc22a26 C A 19: 7,802,181 R90L probably damaging Het
Slitrk5 T C 14: 111,680,216 V424A probably damaging Het
Smarca2 G T 19: 26,720,855 E89* probably null Het
Soga1 C T 2: 157,022,856 G1144D probably benign Het
Stab2 T A 10: 86,937,909 S853C probably damaging Het
Stk17b A T 1: 53,761,147 probably null Het
Taar5 T A 10: 23,971,547 I281N possibly damaging Het
Tarsl2 A T 7: 65,658,935 E284D probably damaging Het
Tbx15 C A 3: 99,316,333 T279K probably damaging Het
Tfr2 G A 5: 137,586,925 V740I probably benign Het
Tlr12 T C 4: 128,617,680 E259G probably benign Het
Tmem145 A G 7: 25,309,034 T302A probably benign Het
Tmem57 A G 4: 134,828,133 I343T probably benign Het
Trpa1 G T 1: 14,875,861 H1015Q probably benign Het
Tspan8 A G 10: 115,817,629 Y10C possibly damaging Het
Ttll7 A G 3: 146,894,469 N44S probably damaging Het
Uba7 T C 9: 107,979,839 probably null Het
Ube2j2 G A 4: 155,946,384 M1I probably null Het
Ubr5 C A 15: 38,009,668 A1022S probably benign Het
Usf1 T G 1: 171,415,763 I36S probably damaging Het
Vmn1r181 A T 7: 23,984,365 D85V probably damaging Het
Vmn1r3 A T 4: 3,185,009 Y99* probably null Het
Vmn1r72 T C 7: 11,670,373 I49M possibly damaging Het
Vmn2r99 A G 17: 19,362,135 M1V probably null Het
Vsig10 T A 5: 117,343,975 V410E probably damaging Het
Zc3h7b A G 15: 81,779,133 Y442C probably damaging Het
Zfyve26 G T 12: 79,280,385 Y730* probably null Het
Other mutations in Klhdc4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01100:Klhdc4 APN 8 121821843 nonsense probably null
IGL01678:Klhdc4 APN 8 121796938 missense possibly damaging 0.73
kilimanjaro UTSW 8 121813790 nonsense probably null
R0577:Klhdc4 UTSW 8 121821351 missense probably damaging 0.99
R0881:Klhdc4 UTSW 8 121799487 nonsense probably null
R1710:Klhdc4 UTSW 8 121799487 nonsense probably null
R2993:Klhdc4 UTSW 8 121806581 nonsense probably null
R3028:Klhdc4 UTSW 8 121799549 missense probably damaging 1.00
R3109:Klhdc4 UTSW 8 121821334 missense probably damaging 1.00
R3711:Klhdc4 UTSW 8 121798055 missense probably benign
R4132:Klhdc4 UTSW 8 121798065 missense possibly damaging 0.79
R4601:Klhdc4 UTSW 8 121799527 missense probably damaging 1.00
R4644:Klhdc4 UTSW 8 121822000 intron probably benign
R4758:Klhdc4 UTSW 8 121798044 missense probably benign 0.00
R5177:Klhdc4 UTSW 8 121813790 nonsense probably null
R5364:Klhdc4 UTSW 8 121806636 intron probably benign
R5475:Klhdc4 UTSW 8 121799572 missense possibly damaging 0.67
R5705:Klhdc4 UTSW 8 121804993 missense probably benign 0.01
R6248:Klhdc4 UTSW 8 121813768 missense probably damaging 1.00
R6326:Klhdc4 UTSW 8 121805054 missense probably damaging 1.00
R6626:Klhdc4 UTSW 8 121820162 missense probably benign 0.43
R7274:Klhdc4 UTSW 8 121799658 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- ACTGTGAAGTCAGGCTAGCC -3'
(R):5'- GTTGCCATTCAGTGTACCCC -3'

Sequencing Primer
(F):5'- TAGCCCCCGTCAGACTGTG -3'
(R):5'- TGACCTGCCTGACTGAGCAAC -3'
Posted On2016-06-06