Incidental Mutation 'R5024:Zan'
ID391218
Institutional Source Beutler Lab
Gene Symbol Zan
Ensembl Gene ENSMUSG00000079173
Gene Namezonadhesin
Synonyms
MMRRC Submission 042615-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.067) question?
Stock #R5024 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location137378637-137477064 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 137461893 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 1245 (C1245*)
Ref Sequence ENSEMBL: ENSMUSP00000132895 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000117564] [ENSMUST00000164178]
Predicted Effect probably null
Transcript: ENSMUST00000117564
AA Change: C1245*
SMART Domains Protein: ENSMUSP00000114068
Gene: ENSMUSG00000079173
AA Change: C1245*

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
MAM 42 210 3.55e-20 SMART
MAM 214 374 3.97e-9 SMART
MAM 375 542 5.7e-42 SMART
low complexity region 549 563 N/A INTRINSIC
low complexity region 578 607 N/A INTRINSIC
low complexity region 637 648 N/A INTRINSIC
low complexity region 672 689 N/A INTRINSIC
low complexity region 702 779 N/A INTRINSIC
low complexity region 782 865 N/A INTRINSIC
low complexity region 890 913 N/A INTRINSIC
low complexity region 941 1038 N/A INTRINSIC
low complexity region 1043 1084 N/A INTRINSIC
low complexity region 1096 1131 N/A INTRINSIC
low complexity region 1136 1147 N/A INTRINSIC
low complexity region 1150 1167 N/A INTRINSIC
low complexity region 1178 1192 N/A INTRINSIC
EGF_like 1236 1259 7.09e1 SMART
VWC 1266 1356 5e-3 SMART
VWD 1316 1477 3.73e-36 SMART
C8 1521 1596 6.91e-23 SMART
EGF_like 1607 1647 6.41e1 SMART
VWC 1654 1745 1.08e-2 SMART
VWD 1703 1869 2.71e-47 SMART
C8 1908 1982 3.45e-32 SMART
Pfam:TIL 1985 2039 4.5e-13 PFAM
VWC 2041 2095 4.84e-1 SMART
FOLN 2074 2096 9.79e1 SMART
VWD 2088 2260 5.49e-25 SMART
C8 2307 2381 6.73e-3 SMART
Pfam:TIL 2384 2442 3e-12 PFAM
VWC 2444 2504 1.13e-1 SMART
FOLN 2475 2498 3.73e0 SMART
EGF_like 2512 2557 6.54e1 SMART
VWC 2564 2637 3.68e-2 SMART
FOLN 2595 2618 4.04e0 SMART
VWC 2684 2744 3.08e-1 SMART
FOLN 2715 2738 7.78e0 SMART
VWC 2804 2864 1.7e0 SMART
FOLN 2835 2858 2.58e1 SMART
VWC 2924 2984 4.74e-1 SMART
VWC 3044 3104 2.44e-1 SMART
VWC 3164 3237 7.57e-2 SMART
FOLN 3195 3218 2.25e1 SMART
VWC 3284 3344 4.22e-1 SMART
FOLN 3315 3338 2.1e0 SMART
VWC 3401 3461 7.67e-2 SMART
FOLN 3432 3455 4.39e0 SMART
VWC 3521 3581 8.45e-2 SMART
FOLN 3552 3575 1.27e1 SMART
VWC 3641 3714 3.51e-1 SMART
FOLN 3672 3695 2.16e0 SMART
VWC 3761 3821 9.7e-2 SMART
FOLN 3792 3815 1.27e1 SMART
VWC 3881 3954 1.83e-1 SMART
FOLN 3912 3933 1.17e1 SMART
VWC 3997 4050 3.61e-1 SMART
FOLN 4028 4051 1.84e0 SMART
EGF_like 4081 4126 5.79e1 SMART
VWC 4133 4210 4.03e-1 SMART
FOLN 4164 4187 7.99e0 SMART
VWC 4253 4308 3.21e-1 SMART
FOLN 4284 4302 8.54e1 SMART
VWC 4368 4428 2.74e-2 SMART
FOLN 4399 4422 7.46e1 SMART
VWC 4488 4548 6.37e-1 SMART
FOLN 4519 4542 1.04e0 SMART
VWC 4608 4681 4.47e-1 SMART
FOLN 4639 4662 2.22e0 SMART
VWC 4728 4781 1.12e0 SMART
FOLN 4759 4782 3.29e1 SMART
EGF 4800 4841 2.43e1 SMART
VWC 4848 4901 7.59e-1 SMART
FOLN 4879 4902 5.31e0 SMART
VWD 4899 5061 4.49e-30 SMART
low complexity region 5086 5102 N/A INTRINSIC
C8 5113 5191 8.25e-21 SMART
Pfam:TIL 5194 5247 1.9e-12 PFAM
VWC 5249 5307 1.22e0 SMART
EGF 5306 5339 3.15e-3 SMART
transmembrane domain 5356 5378 N/A INTRINSIC
low complexity region 5381 5399 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000164178
AA Change: C1245*
SMART Domains Protein: ENSMUSP00000132895
Gene: ENSMUSG00000079173
AA Change: C1245*

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
MAM 42 210 3.55e-20 SMART
MAM 214 374 3.97e-9 SMART
MAM 375 542 5.7e-42 SMART
low complexity region 549 563 N/A INTRINSIC
low complexity region 578 607 N/A INTRINSIC
low complexity region 637 648 N/A INTRINSIC
low complexity region 672 689 N/A INTRINSIC
low complexity region 702 779 N/A INTRINSIC
low complexity region 782 865 N/A INTRINSIC
low complexity region 890 913 N/A INTRINSIC
low complexity region 941 1038 N/A INTRINSIC
low complexity region 1043 1084 N/A INTRINSIC
low complexity region 1096 1131 N/A INTRINSIC
low complexity region 1136 1147 N/A INTRINSIC
low complexity region 1150 1167 N/A INTRINSIC
low complexity region 1178 1192 N/A INTRINSIC
EGF_like 1236 1259 7.09e1 SMART
VWC 1266 1356 5e-3 SMART
VWD 1316 1477 3.73e-36 SMART
C8 1521 1596 6.91e-23 SMART
EGF_like 1607 1647 6.41e1 SMART
VWC 1654 1745 1.08e-2 SMART
VWD 1703 1869 2.71e-47 SMART
C8 1908 1982 3.45e-32 SMART
Pfam:TIL 1985 2039 2.3e-13 PFAM
VWC 2041 2095 4.84e-1 SMART
FOLN 2074 2096 9.79e1 SMART
VWD 2088 2260 5.49e-25 SMART
C8 2307 2381 6.73e-3 SMART
Pfam:TIL 2384 2442 6e-12 PFAM
VWC 2444 2504 1.13e-1 SMART
FOLN 2475 2498 3.73e0 SMART
EGF_like 2512 2557 6.54e1 SMART
VWC 2564 2637 3.68e-2 SMART
FOLN 2595 2618 4.04e0 SMART
VWC 2684 2744 3.08e-1 SMART
FOLN 2715 2738 7.78e0 SMART
VWC 2804 2864 1.7e0 SMART
FOLN 2835 2858 2.58e1 SMART
VWC 2924 2984 4.74e-1 SMART
VWC 3044 3104 2.44e-1 SMART
VWC 3164 3237 7.57e-2 SMART
FOLN 3195 3218 2.25e1 SMART
VWC 3284 3344 4.22e-1 SMART
FOLN 3315 3338 2.1e0 SMART
VWC 3401 3461 7.67e-2 SMART
FOLN 3432 3455 4.39e0 SMART
VWC 3521 3581 8.45e-2 SMART
FOLN 3552 3575 1.27e1 SMART
VWC 3641 3714 3.51e-1 SMART
FOLN 3672 3695 2.16e0 SMART
VWC 3761 3821 9.7e-2 SMART
FOLN 3792 3815 1.27e1 SMART
VWC 3881 3954 1.83e-1 SMART
FOLN 3912 3933 1.17e1 SMART
VWC 3997 4050 3.61e-1 SMART
FOLN 4028 4051 1.84e0 SMART
EGF_like 4081 4126 5.79e1 SMART
VWC 4133 4210 4.03e-1 SMART
FOLN 4164 4187 7.99e0 SMART
VWC 4253 4308 3.21e-1 SMART
FOLN 4284 4302 8.54e1 SMART
VWC 4368 4428 2.74e-2 SMART
FOLN 4399 4422 7.46e1 SMART
VWC 4488 4548 6.37e-1 SMART
FOLN 4519 4542 1.04e0 SMART
VWC 4608 4681 4.47e-1 SMART
FOLN 4639 4662 2.22e0 SMART
VWC 4728 4781 1.12e0 SMART
FOLN 4759 4782 3.29e1 SMART
EGF 4800 4841 2.43e1 SMART
VWC 4848 4901 7.59e-1 SMART
FOLN 4879 4902 5.31e0 SMART
VWD 4899 5061 4.49e-30 SMART
low complexity region 5086 5102 N/A INTRINSIC
C8 5113 5191 8.25e-21 SMART
Pfam:TIL 5194 5247 7.2e-13 PFAM
VWC 5249 5307 1.22e0 SMART
EGF 5306 5339 3.15e-3 SMART
transmembrane domain 5356 5378 N/A INTRINSIC
low complexity region 5381 5399 N/A INTRINSIC
Meta Mutation Damage Score 0.712 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.4%
Validation Efficiency 99% (95/96)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that functions in the species specificity of sperm adhesion to the egg zona pellucida. The encoded protein is located in the acrosome and may be involved in signaling or gamete recognition. An allelic polymorphism in this gene results in both functional and frameshifted alleles; the reference genome represents the functional allele. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jul 2015]
PHENOTYPE: Sperm from mice homozygous for a knock-out allele exhibit decreased species-specific zona pellucida adhesion without alteration in fertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrd1 A G 5: 129,171,895 N575S probably damaging Het
Akap6 C T 12: 53,142,562 T2253M probably benign Het
Arhgef37 A C 18: 61,506,440 N289K probably damaging Het
Armc4 T C 18: 7,088,555 M1005V probably benign Het
Atad2b A C 12: 4,937,534 T121P probably benign Het
Atp4a A C 7: 30,715,864 D303A possibly damaging Het
BC005561 A G 5: 104,522,258 K1549E possibly damaging Het
Calu A T 6: 29,374,519 probably benign Het
Ccdc141 A C 2: 77,054,703 N531K probably benign Het
Ccdc146 T C 5: 21,399,614 probably null Het
Cd207 G A 6: 83,674,319 T218I probably damaging Het
Cd2ap A C 17: 42,805,345 probably null Het
Clip3 G A 7: 30,292,219 probably benign Het
Clstn1 G A 4: 149,635,294 R432H possibly damaging Het
Csmd2 A G 4: 128,321,348 Y521C possibly damaging Het
Dnah8 A T 17: 30,736,096 E2033V probably damaging Het
Eng T G 2: 32,673,392 V319G probably benign Het
Erp44 C T 4: 48,241,296 W57* probably null Het
Etv1 T A 12: 38,854,234 probably null Het
Eva1c T C 16: 90,876,193 probably null Het
Fam196a A G 7: 134,918,478 S108P probably damaging Het
Fam221b T A 4: 43,659,674 N482I probably damaging Het
Fam83h T C 15: 76,005,142 H202R probably damaging Het
Fbxw13 T C 9: 109,179,335 T449A probably benign Het
Fbxw25 A T 9: 109,663,374 probably null Het
Frmd3 T A 4: 74,098,144 S99T probably benign Het
Gm5155 A G 7: 17,910,682 I575V probably benign Het
Gm5174 G T 10: 86,656,587 noncoding transcript Het
Gm6904 T C 14: 59,258,483 probably null Het
Gm815 C T 19: 26,887,775 Q49* probably null Het
H2-DMa A T 17: 34,138,487 I245F possibly damaging Het
Herc1 A T 9: 66,470,326 K3458M possibly damaging Het
Hirip3 A G 7: 126,864,489 probably null Het
Hjurp A T 1: 88,275,050 Y71N possibly damaging Het
Hmcn1 T A 1: 150,680,688 E2449V possibly damaging Het
Igll1 G T 16: 16,863,793 H33N probably benign Het
Il6 T C 5: 30,019,514 L184P probably damaging Het
Impg2 T A 16: 56,260,100 S756T probably damaging Het
Kank4 T G 4: 98,785,661 D5A probably damaging Het
Kcna7 G A 7: 45,406,591 R77H probably damaging Het
Kcns2 A T 15: 34,839,537 T349S probably benign Het
Keap1 A G 9: 21,237,226 Y162H probably damaging Het
Kif9 T C 9: 110,483,093 F10L possibly damaging Het
Klhdc8b ACACGCACGCACGCACGCACGCACGCACGCACGCACGCAC ACACGCACGCACGCACGCACGCACGCACGCACGCACGCACGCAC 9: 108,448,985 probably benign Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Lpar6 A G 14: 73,239,369 T257A probably damaging Het
Lpin1 A T 12: 16,554,006 L608Q probably benign Het
Lyst T C 13: 13,634,404 S220P probably benign Het
M1ap A G 6: 83,028,358 probably benign Het
Mbd6 C T 10: 127,286,441 V173I probably benign Het
Myo5b A T 18: 74,716,034 T1115S possibly damaging Het
Mysm1 C A 4: 94,951,016 V683F possibly damaging Het
Nlrp4g T A 9: 124,350,155 noncoding transcript Het
Olfr1040 G T 2: 86,146,533 A67E probably damaging Het
Olfr1062 C T 2: 86,423,461 G72S possibly damaging Het
Olfr292 A T 7: 86,694,881 M142L probably benign Het
Olfr318 T A 11: 58,720,950 I33F probably benign Het
Otud6b T A 4: 14,826,293 Q34L probably damaging Het
Parp11 C T 6: 127,471,636 T72I probably damaging Het
Pbx1 T A 1: 168,183,589 D343V possibly damaging Het
Ppp1r12b G T 1: 134,955,733 A17E probably benign Het
Pramef20 C A 4: 144,373,308 E296* probably null Het
Ranbp9 A T 13: 43,434,855 I67N probably damaging Het
Rasgrp4 A G 7: 29,148,407 E414G probably damaging Het
Rbbp5 A G 1: 132,490,488 H15R possibly damaging Het
Scd2 A G 19: 44,301,271 Y235C probably benign Het
Sdr16c5 C T 4: 4,010,365 G170S probably damaging Het
Sh3bp4 G T 1: 89,145,595 G722C probably damaging Het
Shmt1 A T 11: 60,797,479 probably benign Het
Slc12a1 A G 2: 125,166,137 I206V probably benign Het
Slc26a3 A G 12: 31,453,908 D304G probably benign Het
Slc26a7 T A 4: 14,532,572 D434V possibly damaging Het
Slc6a16 G T 7: 45,259,966 M185I probably benign Het
Stat4 A G 1: 52,082,570 I363V possibly damaging Het
Tgfb1i1 G T 7: 128,248,217 M1I probably null Het
Tmem225 T C 9: 40,149,343 V66A probably benign Het
Tmtc4 T C 14: 122,941,302 probably null Het
Trpc4 T A 3: 54,194,796 N38K probably benign Het
Ttll12 A T 15: 83,587,113 Y218N probably damaging Het
Ttn A T 2: 76,948,425 probably null Het
Tulp1 A C 17: 28,351,995 Y178* probably null Het
Vmn2r58 A G 7: 41,864,322 V299A probably damaging Het
Washc4 C A 10: 83,583,336 Q911K possibly damaging Het
Wdr3 T C 3: 100,154,936 D221G probably benign Het
Zfyve9 A C 4: 108,691,669 S773A probably benign Het
Other mutations in Zan
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Zan APN 5 137387820 critical splice donor site probably null
IGL00158:Zan APN 5 137454257 missense unknown
IGL00473:Zan APN 5 137464250 missense possibly damaging 0.68
IGL00536:Zan APN 5 137446682 missense unknown
IGL00567:Zan APN 5 137416277 unclassified probably benign
IGL00820:Zan APN 5 137386364 missense unknown
IGL00850:Zan APN 5 137464113 missense unknown
IGL00906:Zan APN 5 137389360 missense unknown
IGL00920:Zan APN 5 137464524 missense unknown
IGL00964:Zan APN 5 137405941 unclassified probably benign
IGL01356:Zan APN 5 137436432 missense unknown
IGL01361:Zan APN 5 137414342 unclassified probably benign
IGL01362:Zan APN 5 137452450 missense unknown
IGL01411:Zan APN 5 137388893 missense unknown
IGL01412:Zan APN 5 137393032 missense unknown
IGL01531:Zan APN 5 137424612 missense unknown
IGL01561:Zan APN 5 137463866 missense unknown
IGL01564:Zan APN 5 137446733 missense unknown
IGL01568:Zan APN 5 137464844 missense unknown
IGL01719:Zan APN 5 137395654 missense unknown
IGL01732:Zan APN 5 137393011 missense unknown
IGL01761:Zan APN 5 137425597 missense unknown
IGL01771:Zan APN 5 137393068 missense unknown
IGL01810:Zan APN 5 137463626 missense unknown
IGL01845:Zan APN 5 137380854 unclassified probably benign
IGL01885:Zan APN 5 137464124 missense unknown
IGL01992:Zan APN 5 137424106 missense unknown
IGL02026:Zan APN 5 137405464 unclassified probably benign
IGL02065:Zan APN 5 137386960 nonsense probably null
IGL02133:Zan APN 5 137411498 missense possibly damaging 0.84
IGL02274:Zan APN 5 137421167 missense unknown
IGL02449:Zan APN 5 137389327 missense unknown
IGL02456:Zan APN 5 137446844 missense unknown
IGL02493:Zan APN 5 137435706 missense unknown
IGL02496:Zan APN 5 137464794 nonsense probably null
IGL02528:Zan APN 5 137465141 missense possibly damaging 0.83
IGL02550:Zan APN 5 137387039 missense unknown
IGL02598:Zan APN 5 137446211 missense unknown
IGL02697:Zan APN 5 137400548 missense unknown
IGL02933:Zan APN 5 137428414 missense unknown
IGL02963:Zan APN 5 137456250 missense unknown
IGL02972:Zan APN 5 137463686 missense unknown
IGL03068:Zan APN 5 137476415 missense probably damaging 1.00
IGL03104:Zan APN 5 137463500 missense unknown
IGL03110:Zan APN 5 137420016 missense unknown
IGL03156:Zan APN 5 137463939 missense unknown
IGL03302:Zan APN 5 137468390 missense possibly damaging 0.93
IGL03307:Zan APN 5 137474025 missense probably damaging 0.99
IGL03340:Zan APN 5 137427874 missense unknown
IGL03379:Zan APN 5 137464215 missense unknown
IGL03405:Zan APN 5 137424597 missense unknown
befallen UTSW 5 137412676 unclassified probably benign
befell UTSW 5 137446037 intron probably null
PIT4283001:Zan UTSW 5 137400093 missense unknown
PIT4431001:Zan UTSW 5 137392064 missense unknown
PIT4498001:Zan UTSW 5 137417036 critical splice donor site probably null
R0027:Zan UTSW 5 137406519 unclassified probably benign
R0047:Zan UTSW 5 137403656 missense unknown
R0149:Zan UTSW 5 137396766 missense unknown
R0240:Zan UTSW 5 137398362 missense unknown
R0240:Zan UTSW 5 137398362 missense unknown
R0241:Zan UTSW 5 137421822 missense unknown
R0241:Zan UTSW 5 137421822 missense unknown
R0361:Zan UTSW 5 137396766 missense unknown
R0432:Zan UTSW 5 137382316 unclassified probably benign
R0436:Zan UTSW 5 137464902 missense unknown
R0446:Zan UTSW 5 137391658 missense unknown
R0457:Zan UTSW 5 137407706 unclassified probably benign
R0478:Zan UTSW 5 137400526 splice site probably benign
R0487:Zan UTSW 5 137413358 critical splice donor site probably null
R0497:Zan UTSW 5 137412676 unclassified probably benign
R0504:Zan UTSW 5 137470318 missense probably damaging 1.00
R0545:Zan UTSW 5 137396177 missense unknown
R0556:Zan UTSW 5 137454220 missense unknown
R0615:Zan UTSW 5 137468431 missense probably damaging 1.00
R0737:Zan UTSW 5 137389249 missense unknown
R0835:Zan UTSW 5 137408397 unclassified probably benign
R0863:Zan UTSW 5 137458639 missense unknown
R0971:Zan UTSW 5 137434063 missense unknown
R1327:Zan UTSW 5 137465911 splice site probably benign
R1338:Zan UTSW 5 137393651 nonsense probably null
R1413:Zan UTSW 5 137427939 missense unknown
R1446:Zan UTSW 5 137389360 missense unknown
R1464:Zan UTSW 5 137419929 missense unknown
R1464:Zan UTSW 5 137419929 missense unknown
R1561:Zan UTSW 5 137380838 nonsense probably null
R1569:Zan UTSW 5 137429130 missense unknown
R1575:Zan UTSW 5 137461952 missense unknown
R1618:Zan UTSW 5 137383830 missense unknown
R1634:Zan UTSW 5 137412790 unclassified probably benign
R1650:Zan UTSW 5 137394601 splice site probably benign
R1680:Zan UTSW 5 137403050 missense unknown
R1698:Zan UTSW 5 137409669 utr 3 prime probably benign
R1704:Zan UTSW 5 137434002 nonsense probably null
R1728:Zan UTSW 5 137415018 unclassified probably benign
R1729:Zan UTSW 5 137415018 unclassified probably benign
R1769:Zan UTSW 5 137464518 missense unknown
R1774:Zan UTSW 5 137419989 missense unknown
R1800:Zan UTSW 5 137386451 missense unknown
R1858:Zan UTSW 5 137405877 unclassified probably benign
R1888:Zan UTSW 5 137389328 missense unknown
R1888:Zan UTSW 5 137389328 missense unknown
R1925:Zan UTSW 5 137425642 missense unknown
R1938:Zan UTSW 5 137388939 missense unknown
R1955:Zan UTSW 5 137389283 missense unknown
R1989:Zan UTSW 5 137420006 nonsense probably null
R1997:Zan UTSW 5 137403114 nonsense probably null
R2008:Zan UTSW 5 137452450 missense unknown
R2035:Zan UTSW 5 137443947 missense unknown
R2153:Zan UTSW 5 137436400 missense unknown
R2154:Zan UTSW 5 137414249 unclassified probably benign
R2176:Zan UTSW 5 137421848 missense unknown
R2217:Zan UTSW 5 137410306 utr 3 prime probably benign
R2218:Zan UTSW 5 137410306 utr 3 prime probably benign
R2237:Zan UTSW 5 137457837 nonsense probably null
R2239:Zan UTSW 5 137457837 nonsense probably null
R2346:Zan UTSW 5 137421867 missense unknown
R2360:Zan UTSW 5 137396126 missense unknown
R2389:Zan UTSW 5 137476380 critical splice donor site probably null
R2412:Zan UTSW 5 137414163 splice site probably null
R2426:Zan UTSW 5 137388992 missense unknown
R2435:Zan UTSW 5 137438574 missense unknown
R2509:Zan UTSW 5 137456586 missense unknown
R3416:Zan UTSW 5 137435720 missense unknown
R3691:Zan UTSW 5 137420019 missense unknown
R3853:Zan UTSW 5 137474064 missense probably damaging 1.00
R4006:Zan UTSW 5 137463939 missense unknown
R4007:Zan UTSW 5 137463939 missense unknown
R4033:Zan UTSW 5 137437860 nonsense probably null
R4059:Zan UTSW 5 137436820 missense unknown
R4109:Zan UTSW 5 137458619 missense unknown
R4194:Zan UTSW 5 137463555 missense unknown
R4226:Zan UTSW 5 137423978 missense unknown
R4457:Zan UTSW 5 137411516 missense unknown
R4544:Zan UTSW 5 137383834 missense unknown
R4546:Zan UTSW 5 137383834 missense unknown
R4642:Zan UTSW 5 137464188 missense unknown
R4708:Zan UTSW 5 137446712 missense unknown
R4773:Zan UTSW 5 137436313 splice site probably benign
R4774:Zan UTSW 5 137389019 missense unknown
R4788:Zan UTSW 5 137442113 missense unknown
R4795:Zan UTSW 5 137380850 nonsense probably null
R4796:Zan UTSW 5 137380850 nonsense probably null
R4812:Zan UTSW 5 137456285 missense unknown
R4832:Zan UTSW 5 137393161 missense unknown
R4882:Zan UTSW 5 137438448 missense unknown
R4896:Zan UTSW 5 137386456 missense unknown
R4921:Zan UTSW 5 137408370 unclassified probably benign
R4943:Zan UTSW 5 137457890 missense unknown
R4978:Zan UTSW 5 137406921 unclassified probably benign
R5013:Zan UTSW 5 137383837 missense unknown
R5230:Zan UTSW 5 137454078 missense unknown
R5354:Zan UTSW 5 137380788 unclassified probably benign
R5380:Zan UTSW 5 137457840 missense unknown
R5394:Zan UTSW 5 137435634 missense unknown
R5394:Zan UTSW 5 137464074 missense unknown
R5435:Zan UTSW 5 137403762 missense unknown
R5441:Zan UTSW 5 137436751 missense unknown
R5447:Zan UTSW 5 137472191 missense probably damaging 1.00
R5455:Zan UTSW 5 137454000 missense unknown
R5495:Zan UTSW 5 137470408 missense probably damaging 1.00
R5496:Zan UTSW 5 137436345 missense unknown
R5523:Zan UTSW 5 137421893 missense unknown
R5534:Zan UTSW 5 137438451 missense unknown
R5572:Zan UTSW 5 137394431 missense unknown
R5576:Zan UTSW 5 137428482 nonsense probably null
R5587:Zan UTSW 5 137391762 missense unknown
R5593:Zan UTSW 5 137468338 missense possibly damaging 0.72
R5600:Zan UTSW 5 137386971 missense unknown
R5682:Zan UTSW 5 137414259 nonsense probably null
R5712:Zan UTSW 5 137400098 missense unknown
R5751:Zan UTSW 5 137410161 intron probably null
R5782:Zan UTSW 5 137420007 missense unknown
R5835:Zan UTSW 5 137456655 missense unknown
R5846:Zan UTSW 5 137394376 splice site probably null
R5903:Zan UTSW 5 137442134 missense unknown
R5911:Zan UTSW 5 137457912 missense unknown
R5935:Zan UTSW 5 137443930 missense unknown
R5985:Zan UTSW 5 137446037 intron probably null
R5995:Zan UTSW 5 137378809 unclassified probably benign
R6012:Zan UTSW 5 137464529 missense unknown
R6077:Zan UTSW 5 137414297 unclassified probably benign
R6227:Zan UTSW 5 137468343 missense probably damaging 0.96
R6262:Zan UTSW 5 137429485 intron probably null
R6337:Zan UTSW 5 137452488 missense unknown
R6598:Zan UTSW 5 137406364 unclassified probably benign
R6725:Zan UTSW 5 137438520 missense unknown
R6765:Zan UTSW 5 137393147 missense unknown
R6820:Zan UTSW 5 137407844 unclassified probably benign
R6829:Zan UTSW 5 137416278 unclassified probably benign
R6851:Zan UTSW 5 137396191 missense unknown
R6903:Zan UTSW 5 137456304 missense unknown
R6910:Zan UTSW 5 137419080 missense unknown
R6968:Zan UTSW 5 137461813 missense unknown
R7021:Zan UTSW 5 137423951 missense unknown
R7039:Zan UTSW 5 137400134 missense unknown
R7101:Zan UTSW 5 137398290 missense unknown
R7102:Zan UTSW 5 137454200 critical splice donor site probably null
R7155:Zan UTSW 5 137461844 missense unknown
R7158:Zan UTSW 5 137400644 missense unknown
R7170:Zan UTSW 5 137463494 missense unknown
R7203:Zan UTSW 5 137434096 missense unknown
R7204:Zan UTSW 5 137427978 missense unknown
R7305:Zan UTSW 5 137415139 missense unknown
X0062:Zan UTSW 5 137446238 missense unknown
X0066:Zan UTSW 5 137464430 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGTCCCTTGAGACTCTCTAAGC -3'
(R):5'- TACAGATGTGTTCAGGAGCAC -3'

Sequencing Primer
(F):5'- GAGACTCTCTAAGCTCCTCTCACAC -3'
(R):5'- TCCTGGCCTCAAATGAGTATG -3'
Posted On2016-06-06