Incidental Mutation 'R5024:Ccdc141'
ID391198
Institutional Source Beutler Lab
Gene Symbol Ccdc141
Ensembl Gene ENSMUSG00000044033
Gene Namecoiled-coil domain containing 141
SynonymsENSMUSG00000075261, 2610301F02Rik, CAMDI
MMRRC Submission 042615-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.460) question?
Stock #R5024 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location77009902-77170636 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 77054703 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 531 (N531K)
Ref Sequence ENSEMBL: ENSMUSP00000052945 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049544] [ENSMUST00000164114]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000028406
Predicted Effect probably benign
Transcript: ENSMUST00000049544
AA Change: N531K

PolyPhen 2 Score 0.174 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000052945
Gene: ENSMUSG00000044033
AA Change: N531K

DomainStartEndE-ValueType
SPEC 26 128 2.87e-1 SMART
Blast:SPEC 132 222 1e-40 BLAST
low complexity region 223 251 N/A INTRINSIC
SPEC 252 353 3.61e-1 SMART
Blast:SPEC 356 453 2e-49 BLAST
Blast:SPEC 461 562 1e-16 BLAST
low complexity region 569 583 N/A INTRINSIC
Blast:SPEC 688 772 7e-30 BLAST
low complexity region 773 785 N/A INTRINSIC
Blast:SPEC 790 894 2e-24 BLAST
Blast:SPEC 907 1009 4e-44 BLAST
Blast:SPEC 1012 1118 9e-63 BLAST
low complexity region 1203 1231 N/A INTRINSIC
Blast:IG 1305 1416 5e-54 BLAST
SCOP:d1g1ca_ 1406 1443 1e-9 SMART
Blast:IG 1416 1444 2e-9 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000164114
AA Change: N531K

PolyPhen 2 Score 0.027 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000128736
Gene: ENSMUSG00000044033
AA Change: N531K

DomainStartEndE-ValueType
SPEC 26 128 2.87e-1 SMART
Blast:SPEC 132 222 2e-40 BLAST
low complexity region 223 251 N/A INTRINSIC
SPEC 252 353 3.61e-1 SMART
Blast:SPEC 356 453 2e-49 BLAST
Blast:SPEC 461 562 1e-16 BLAST
low complexity region 569 583 N/A INTRINSIC
Blast:SPEC 688 772 7e-30 BLAST
low complexity region 773 785 N/A INTRINSIC
Blast:SPEC 790 894 3e-24 BLAST
Blast:SPEC 907 1009 4e-44 BLAST
Blast:SPEC 1012 1118 1e-62 BLAST
low complexity region 1203 1231 N/A INTRINSIC
IGc2 1422 1489 1.27e-5 SMART
transmembrane domain 1510 1529 N/A INTRINSIC
Meta Mutation Damage Score 0.1132 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.4%
Validation Efficiency 99% (95/96)
MGI Phenotype PHENOTYPE: Homozygous knockout impairs migration of neurons in the somatosensory cortex, resulting in increased anxiety and hyperactivity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrd1 A G 5: 129,171,895 N575S probably damaging Het
Akap6 C T 12: 53,142,562 T2253M probably benign Het
Arhgef37 A C 18: 61,506,440 N289K probably damaging Het
Armc4 T C 18: 7,088,555 M1005V probably benign Het
Atad2b A C 12: 4,937,534 T121P probably benign Het
Atp4a A C 7: 30,715,864 D303A possibly damaging Het
BC005561 A G 5: 104,522,258 K1549E possibly damaging Het
Calu A T 6: 29,374,519 probably benign Het
Ccdc146 T C 5: 21,399,614 probably null Het
Cd207 G A 6: 83,674,319 T218I probably damaging Het
Cd2ap A C 17: 42,805,345 probably null Het
Clip3 G A 7: 30,292,219 probably benign Het
Clstn1 G A 4: 149,635,294 R432H possibly damaging Het
Csmd2 A G 4: 128,321,348 Y521C possibly damaging Het
Dnah8 A T 17: 30,736,096 E2033V probably damaging Het
Eng T G 2: 32,673,392 V319G probably benign Het
Erp44 C T 4: 48,241,296 W57* probably null Het
Etv1 T A 12: 38,854,234 probably null Het
Eva1c T C 16: 90,876,193 probably null Het
Fam196a A G 7: 134,918,478 S108P probably damaging Het
Fam221b T A 4: 43,659,674 N482I probably damaging Het
Fam83h T C 15: 76,005,142 H202R probably damaging Het
Fbxw13 T C 9: 109,179,335 T449A probably benign Het
Fbxw25 A T 9: 109,663,374 probably null Het
Frmd3 T A 4: 74,098,144 S99T probably benign Het
Gm5155 A G 7: 17,910,682 I575V probably benign Het
Gm5174 G T 10: 86,656,587 noncoding transcript Het
Gm6904 T C 14: 59,258,483 probably null Het
Gm815 C T 19: 26,887,775 Q49* probably null Het
H2-DMa A T 17: 34,138,487 I245F possibly damaging Het
Herc1 A T 9: 66,470,326 K3458M possibly damaging Het
Hirip3 A G 7: 126,864,489 probably null Het
Hjurp A T 1: 88,275,050 Y71N possibly damaging Het
Hmcn1 T A 1: 150,680,688 E2449V possibly damaging Het
Igll1 G T 16: 16,863,793 H33N probably benign Het
Il6 T C 5: 30,019,514 L184P probably damaging Het
Impg2 T A 16: 56,260,100 S756T probably damaging Het
Kank4 T G 4: 98,785,661 D5A probably damaging Het
Kcna7 G A 7: 45,406,591 R77H probably damaging Het
Kcns2 A T 15: 34,839,537 T349S probably benign Het
Keap1 A G 9: 21,237,226 Y162H probably damaging Het
Kif9 T C 9: 110,483,093 F10L possibly damaging Het
Klhdc8b ACACGCACGCACGCACGCACGCACGCACGCACGCACGCAC ACACGCACGCACGCACGCACGCACGCACGCACGCACGCACGCAC 9: 108,448,985 probably benign Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Lpar6 A G 14: 73,239,369 T257A probably damaging Het
Lpin1 A T 12: 16,554,006 L608Q probably benign Het
Lyst T C 13: 13,634,404 S220P probably benign Het
M1ap A G 6: 83,028,358 probably benign Het
Mbd6 C T 10: 127,286,441 V173I probably benign Het
Myo5b A T 18: 74,716,034 T1115S possibly damaging Het
Mysm1 C A 4: 94,951,016 V683F possibly damaging Het
Nlrp4g T A 9: 124,350,155 noncoding transcript Het
Olfr1040 G T 2: 86,146,533 A67E probably damaging Het
Olfr1062 C T 2: 86,423,461 G72S possibly damaging Het
Olfr292 A T 7: 86,694,881 M142L probably benign Het
Olfr318 T A 11: 58,720,950 I33F probably benign Het
Otud6b T A 4: 14,826,293 Q34L probably damaging Het
Parp11 C T 6: 127,471,636 T72I probably damaging Het
Pbx1 T A 1: 168,183,589 D343V possibly damaging Het
Ppp1r12b G T 1: 134,955,733 A17E probably benign Het
Pramef20 C A 4: 144,373,308 E296* probably null Het
Ranbp9 A T 13: 43,434,855 I67N probably damaging Het
Rasgrp4 A G 7: 29,148,407 E414G probably damaging Het
Rbbp5 A G 1: 132,490,488 H15R possibly damaging Het
Scd2 A G 19: 44,301,271 Y235C probably benign Het
Sdr16c5 C T 4: 4,010,365 G170S probably damaging Het
Sh3bp4 G T 1: 89,145,595 G722C probably damaging Het
Shmt1 A T 11: 60,797,479 probably benign Het
Slc12a1 A G 2: 125,166,137 I206V probably benign Het
Slc26a3 A G 12: 31,453,908 D304G probably benign Het
Slc26a7 T A 4: 14,532,572 D434V possibly damaging Het
Slc6a16 G T 7: 45,259,966 M185I probably benign Het
Stat4 A G 1: 52,082,570 I363V possibly damaging Het
Tgfb1i1 G T 7: 128,248,217 M1I probably null Het
Tmem225 T C 9: 40,149,343 V66A probably benign Het
Tmtc4 T C 14: 122,941,302 probably null Het
Trpc4 T A 3: 54,194,796 N38K probably benign Het
Ttll12 A T 15: 83,587,113 Y218N probably damaging Het
Ttn A T 2: 76,948,425 probably null Het
Tulp1 A C 17: 28,351,995 Y178* probably null Het
Vmn2r58 A G 7: 41,864,322 V299A probably damaging Het
Washc4 C A 10: 83,583,336 Q911K possibly damaging Het
Wdr3 T C 3: 100,154,936 D221G probably benign Het
Zan A T 5: 137,461,893 C1245* probably null Het
Zfyve9 A C 4: 108,691,669 S773A probably benign Het
Other mutations in Ccdc141
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00517:Ccdc141 APN 2 77054644 missense probably damaging 0.98
IGL01396:Ccdc141 APN 2 77128325 missense possibly damaging 0.87
IGL01408:Ccdc141 APN 2 77045679 missense probably benign 0.01
IGL01633:Ccdc141 APN 2 77089249 missense probably benign 0.01
IGL01982:Ccdc141 APN 2 77030659 missense probably damaging 1.00
IGL02105:Ccdc141 APN 2 77049577 critical splice donor site probably null
IGL02307:Ccdc141 APN 2 77029342 missense probably damaging 1.00
IGL02645:Ccdc141 APN 2 77074867 nonsense probably null
IGL02737:Ccdc141 APN 2 77057924 missense probably damaging 0.97
IGL02740:Ccdc141 APN 2 77054609 missense probably benign 0.05
IGL02949:Ccdc141 APN 2 77027594 missense probably damaging 1.00
IGL03127:Ccdc141 APN 2 77029235 critical splice donor site probably null
verloren UTSW 2 77027648 missense probably damaging 1.00
verschied UTSW 2 77108356 splice site probably benign
R0153:Ccdc141 UTSW 2 77165238 intron probably benign
R0384:Ccdc141 UTSW 2 77027648 missense probably damaging 1.00
R0423:Ccdc141 UTSW 2 77039450 missense probably damaging 0.96
R0573:Ccdc141 UTSW 2 77039493 missense probably benign 0.00
R1332:Ccdc141 UTSW 2 77014440 missense probably damaging 1.00
R1336:Ccdc141 UTSW 2 77014440 missense probably damaging 1.00
R1355:Ccdc141 UTSW 2 77030601 missense probably damaging 1.00
R1416:Ccdc141 UTSW 2 77014796 missense probably damaging 1.00
R1659:Ccdc141 UTSW 2 77054683 missense probably benign 0.41
R1726:Ccdc141 UTSW 2 77108356 splice site probably benign
R1799:Ccdc141 UTSW 2 77011671 missense possibly damaging 0.88
R1837:Ccdc141 UTSW 2 77011665 missense probably benign 0.00
R1839:Ccdc141 UTSW 2 77011665 missense probably benign 0.00
R1918:Ccdc141 UTSW 2 77014703 missense probably benign 0.00
R2019:Ccdc141 UTSW 2 77011565 missense probably damaging 1.00
R2133:Ccdc141 UTSW 2 77059607 missense probably benign 0.28
R2158:Ccdc141 UTSW 2 77030671 missense probably damaging 1.00
R2256:Ccdc141 UTSW 2 77132262 missense probably damaging 1.00
R2359:Ccdc141 UTSW 2 77170402 missense probably damaging 1.00
R2382:Ccdc141 UTSW 2 77011542 missense probably damaging 1.00
R2382:Ccdc141 UTSW 2 77074998 missense probably benign 0.11
R3110:Ccdc141 UTSW 2 77039486 missense probably benign 0.31
R3112:Ccdc141 UTSW 2 77039486 missense probably benign 0.31
R4334:Ccdc141 UTSW 2 77170432 missense probably damaging 1.00
R4493:Ccdc141 UTSW 2 77132297 missense probably damaging 1.00
R4494:Ccdc141 UTSW 2 77132297 missense probably damaging 1.00
R4628:Ccdc141 UTSW 2 77059680 missense probably benign 0.02
R4748:Ccdc141 UTSW 2 77057980 missense possibly damaging 0.67
R4810:Ccdc141 UTSW 2 77045755 missense possibly damaging 0.73
R4824:Ccdc141 UTSW 2 77124336 missense probably damaging 0.99
R4829:Ccdc141 UTSW 2 77074916 missense probably damaging 0.99
R4920:Ccdc141 UTSW 2 77168563 missense probably damaging 1.00
R5073:Ccdc141 UTSW 2 77124378 splice site probably null
R5251:Ccdc141 UTSW 2 77027774 missense probably damaging 1.00
R5252:Ccdc141 UTSW 2 77132249 missense probably benign 0.03
R5534:Ccdc141 UTSW 2 77057897 missense probably benign
R5539:Ccdc141 UTSW 2 77015093 missense probably damaging 0.98
R5551:Ccdc141 UTSW 2 77014409 missense probably damaging 1.00
R5784:Ccdc141 UTSW 2 77029327 missense probably damaging 1.00
R5837:Ccdc141 UTSW 2 77108437 missense possibly damaging 0.56
R5850:Ccdc141 UTSW 2 77029403 missense probably damaging 0.98
R6050:Ccdc141 UTSW 2 77011731 missense probably benign 0.33
R6263:Ccdc141 UTSW 2 77108463 missense probably damaging 1.00
R6502:Ccdc141 UTSW 2 77170401 missense probably damaging 1.00
R6580:Ccdc141 UTSW 2 77011755 missense possibly damaging 0.50
R6865:Ccdc141 UTSW 2 77029235 critical splice donor site probably null
R7014:Ccdc141 UTSW 2 77132297 missense probably damaging 1.00
R7094:Ccdc141 UTSW 2 77041453 missense possibly damaging 0.83
R7195:Ccdc141 UTSW 2 77049583 missense probably benign 0.39
R7300:Ccdc141 UTSW 2 77014694 missense probably benign 0.00
Z1088:Ccdc141 UTSW 2 77128272 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- AAGATGGACAGAGGCCATCC -3'
(R):5'- AGATGGCTTTCAGATTCAAGTGCC -3'

Sequencing Primer
(F):5'- ACAGAGGCCATCCTGCTGAAG -3'
(R):5'- AGTTACACCTTTCTTTGATTGAGG -3'
Posted On2016-06-06