Incidental Mutation 'R5052:Tacc2'
ID394699
Institutional Source Beutler Lab
Gene Symbol Tacc2
Ensembl Gene ENSMUSG00000030852
Gene Nametransforming, acidic coiled-coil containing protein 2
Synonyms
MMRRC Submission 042642-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5052 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location130577438-130764785 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 130735014 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 171 (D171E)
Ref Sequence ENSEMBL: ENSMUSP00000146908 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033141] [ENSMUST00000059145] [ENSMUST00000084513] [ENSMUST00000124096] [ENSMUST00000207282] [ENSMUST00000207376] [ENSMUST00000207395] [ENSMUST00000207549] [ENSMUST00000207789] [ENSMUST00000208722] [ENSMUST00000208743] [ENSMUST00000209108]
Predicted Effect probably damaging
Transcript: ENSMUST00000033141
AA Change: D558E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000033141
Gene: ENSMUSG00000030852
AA Change: D558E

DomainStartEndE-ValueType
low complexity region 37 63 N/A INTRINSIC
internal_repeat_1 71 181 1.04e-5 PROSPERO
low complexity region 235 246 N/A INTRINSIC
internal_repeat_2 258 345 6.53e-5 PROSPERO
internal_repeat_1 373 456 1.04e-5 PROSPERO
low complexity region 461 476 N/A INTRINSIC
low complexity region 493 504 N/A INTRINSIC
low complexity region 538 552 N/A INTRINSIC
internal_repeat_2 629 716 6.53e-5 PROSPERO
coiled coil region 763 790 N/A INTRINSIC
Pfam:TACC 829 1035 3.4e-85 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000059145
AA Change: D668E

PolyPhen 2 Score 0.964 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000061242
Gene: ENSMUSG00000030852
AA Change: D668E

DomainStartEndE-ValueType
low complexity region 87 102 N/A INTRINSIC
low complexity region 147 173 N/A INTRINSIC
internal_repeat_1 181 291 2.03e-5 PROSPERO
low complexity region 345 356 N/A INTRINSIC
internal_repeat_1 483 566 2.03e-5 PROSPERO
low complexity region 571 586 N/A INTRINSIC
low complexity region 603 614 N/A INTRINSIC
low complexity region 648 662 N/A INTRINSIC
coiled coil region 873 900 N/A INTRINSIC
Pfam:TACC 939 1145 4e-85 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000084513
AA Change: D2375E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000081561
Gene: ENSMUSG00000030852
AA Change: D2375E

DomainStartEndE-ValueType
internal_repeat_1 19 346 3.83e-6 PROSPERO
low complexity region 398 410 N/A INTRINSIC
low complexity region 413 431 N/A INTRINSIC
internal_repeat_1 778 1068 3.83e-6 PROSPERO
low complexity region 1397 1415 N/A INTRINSIC
low complexity region 1723 1739 N/A INTRINSIC
low complexity region 1794 1809 N/A INTRINSIC
low complexity region 1854 1880 N/A INTRINSIC
low complexity region 2052 2063 N/A INTRINSIC
low complexity region 2278 2293 N/A INTRINSIC
low complexity region 2310 2321 N/A INTRINSIC
low complexity region 2355 2369 N/A INTRINSIC
coiled coil region 2606 2633 N/A INTRINSIC
Pfam:TACC 2673 2873 6.1e-87 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000124096
SMART Domains Protein: ENSMUSP00000130971
Gene: ENSMUSG00000030849

DomainStartEndE-ValueType
Pfam:Pkinase 1 118 4.8e-19 PFAM
Pfam:Pkinase_Tyr 1 118 1.7e-50 PFAM
low complexity region 146 160 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000207282
AA Change: D546E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000207376
AA Change: D187E

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Predicted Effect probably damaging
Transcript: ENSMUST00000207395
AA Change: D402E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000207549
AA Change: D167E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000207789
Predicted Effect probably damaging
Transcript: ENSMUST00000208722
AA Change: D668E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000208743
AA Change: D558E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000209108
AA Change: D171E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.104 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.0%
  • 10x: 94.8%
  • 20x: 86.2%
Validation Efficiency 100% (58/58)
MGI Phenotype FUNCTION: This gene encodes a member of the transforming, acidic coiled-coil (TACC) family of proteins. Members of this family are centrosomal proteins that interact with microtubules and tubulin. TACC proteins are thought to be involved in centrosome/mitotic spindle dynamics and gene regulation. Alternative splicing of this gene results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice are healthy and fertile and do not display any increase in tumorigenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcd3 A T 3: 121,769,513 probably null Het
Adgrv1 T C 13: 81,528,821 T1964A probably damaging Het
Agbl5 C T 5: 30,891,214 T210I possibly damaging Het
Ak5 T C 3: 152,660,567 T66A probably benign Het
Aktip G A 8: 91,129,651 T66I possibly damaging Het
Aldh1l2 T C 10: 83,508,692 Y330C possibly damaging Het
Btbd19 T G 4: 117,122,257 K122Q possibly damaging Het
Cd180 A G 13: 102,704,895 T150A probably benign Het
Celsr2 A G 3: 108,412,358 I1046T probably damaging Het
Cep170 C T 1: 176,793,551 R20Q probably damaging Het
Cercam T A 2: 29,875,627 N260K probably damaging Het
Cfh T A 1: 140,144,044 H284L probably damaging Het
Chmp5 A G 4: 40,948,608 M1V probably null Het
Elp3 A T 14: 65,577,940 I220N probably damaging Het
Esyt2 A G 12: 116,367,796 T765A probably damaging Het
Evi5l T C 8: 4,206,019 probably benign Het
Gm5866 T G 5: 52,582,892 noncoding transcript Het
Grik1 C A 16: 87,950,098 G417V probably benign Het
Gtpbp1 T G 15: 79,715,969 I399R probably damaging Het
Il17rc T C 6: 113,472,323 C14R probably damaging Het
Ipo9 T C 1: 135,388,611 probably null Het
Kazn G A 4: 142,118,203 probably benign Het
Map3k15 T C X: 159,988,746 V105A possibly damaging Het
Mitf A G 6: 98,010,445 T320A possibly damaging Het
Ncapd3 T G 9: 27,051,719 L440R probably damaging Het
Nrxn2 C G 19: 6,455,204 A359G probably damaging Het
P2rx3 T G 2: 84,999,024 I371L probably benign Het
Pde1b C A 15: 103,527,648 Q493K possibly damaging Het
Ptpn13 T C 5: 103,561,980 F1503S probably damaging Het
Ptprz1 T G 6: 23,045,626 W1283G probably damaging Het
Rasd2 T A 8: 75,221,936 D163E possibly damaging Het
Rgs11 A G 17: 26,207,973 probably benign Het
Scap T C 9: 110,353,152 I37T possibly damaging Het
Sgms2 C T 3: 131,330,356 V232M probably benign Het
Slc25a54 A G 3: 109,102,700 I172V probably benign Het
Sympk C T 7: 19,036,042 R215C probably benign Het
Tmco4 A G 4: 139,058,506 E629G probably benign Het
Trav7-1 T G 14: 52,655,308 L106R possibly damaging Het
Ugt1a1 CAGAGAGAGAGAGA CAGAGAGAGAGA 1: 88,211,984 probably benign Het
Utf1 T C 7: 139,944,901 probably benign Het
Zdhhc13 A G 7: 48,824,731 N577S possibly damaging Het
Zmym6 A G 4: 127,123,974 N1183D possibly damaging Het
Other mutations in Tacc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00836:Tacc2 APN 7 130759168 missense probably damaging 1.00
IGL01396:Tacc2 APN 7 130759189 missense probably damaging 0.98
IGL01621:Tacc2 APN 7 130729768 missense probably damaging 0.99
IGL02000:Tacc2 APN 7 130729168 unclassified probably null
IGL02075:Tacc2 APN 7 130728852 missense probably benign 0.03
IGL02201:Tacc2 APN 7 130626212 missense possibly damaging 0.84
IGL02205:Tacc2 APN 7 130626682 missense probably damaging 1.00
IGL02399:Tacc2 APN 7 130623399 missense probably benign 0.15
IGL02456:Tacc2 APN 7 130626261 missense probably benign 0.35
IGL02559:Tacc2 APN 7 130759267 missense probably damaging 1.00
IGL02734:Tacc2 APN 7 130626099 missense probably damaging 0.98
IGL02800:Tacc2 APN 7 130624079 missense probably benign 0.40
IGL02938:Tacc2 APN 7 130728941 missense probably damaging 1.00
IGL03031:Tacc2 APN 7 130623855 missense possibly damaging 0.94
IGL03278:Tacc2 APN 7 130733568 critical splice donor site probably null
IGL03283:Tacc2 APN 7 130742266 missense possibly damaging 0.47
IGL03371:Tacc2 APN 7 130626061 missense possibly damaging 0.90
R0002:Tacc2 UTSW 7 130621785 missense probably damaging 0.99
R0119:Tacc2 UTSW 7 130621875 missense probably damaging 0.98
R0244:Tacc2 UTSW 7 130751825 splice site probably benign
R0619:Tacc2 UTSW 7 130716753 missense probably damaging 1.00
R0624:Tacc2 UTSW 7 130577509 missense probably damaging 0.99
R0632:Tacc2 UTSW 7 130625595 nonsense probably null
R1015:Tacc2 UTSW 7 130624065 missense probably benign
R1081:Tacc2 UTSW 7 130728574 missense possibly damaging 0.46
R1086:Tacc2 UTSW 7 130626497 missense possibly damaging 0.94
R1351:Tacc2 UTSW 7 130663003 intron probably benign
R1538:Tacc2 UTSW 7 130625419 missense probably benign 0.03
R1743:Tacc2 UTSW 7 130626598 nonsense probably null
R1771:Tacc2 UTSW 7 130742240 missense probably damaging 1.00
R1876:Tacc2 UTSW 7 130623745 missense probably benign 0.38
R1893:Tacc2 UTSW 7 130625325 missense probably benign 0.01
R1899:Tacc2 UTSW 7 130624202 missense possibly damaging 0.81
R2005:Tacc2 UTSW 7 130731550 missense probably damaging 1.00
R2131:Tacc2 UTSW 7 130621857 missense possibly damaging 0.90
R2338:Tacc2 UTSW 7 130733569 splice site probably null
R2407:Tacc2 UTSW 7 130622040 missense possibly damaging 0.65
R3051:Tacc2 UTSW 7 130625496 missense possibly damaging 0.81
R3052:Tacc2 UTSW 7 130625496 missense possibly damaging 0.81
R3053:Tacc2 UTSW 7 130625496 missense possibly damaging 0.81
R3116:Tacc2 UTSW 7 130759249 missense probably damaging 1.00
R3412:Tacc2 UTSW 7 130734994 missense probably benign 0.02
R3683:Tacc2 UTSW 7 130625070 missense probably benign 0.40
R3685:Tacc2 UTSW 7 130625070 missense probably benign 0.40
R3872:Tacc2 UTSW 7 130622422 missense probably benign 0.02
R4063:Tacc2 UTSW 7 130729122 missense probably damaging 0.97
R4410:Tacc2 UTSW 7 130742211 missense possibly damaging 0.80
R4434:Tacc2 UTSW 7 130623541 missense probably damaging 0.96
R4438:Tacc2 UTSW 7 130623541 missense probably damaging 0.96
R4618:Tacc2 UTSW 7 130626216 missense probably benign 0.10
R4674:Tacc2 UTSW 7 130624861 missense possibly damaging 0.75
R4742:Tacc2 UTSW 7 130625967 missense probably benign 0.00
R4934:Tacc2 UTSW 7 130728588 missense probably damaging 1.00
R4947:Tacc2 UTSW 7 130625899 missense probably damaging 0.98
R4964:Tacc2 UTSW 7 130728777 missense probably damaging 1.00
R4966:Tacc2 UTSW 7 130728777 missense probably damaging 1.00
R4967:Tacc2 UTSW 7 130623948 missense probably damaging 0.99
R5276:Tacc2 UTSW 7 130729317 missense probably damaging 1.00
R5330:Tacc2 UTSW 7 130733528 missense probably damaging 1.00
R5331:Tacc2 UTSW 7 130733528 missense probably damaging 1.00
R5372:Tacc2 UTSW 7 130623260 missense probably benign 0.09
R5556:Tacc2 UTSW 7 130674606 missense probably damaging 0.97
R5645:Tacc2 UTSW 7 130624051 missense possibly damaging 0.80
R5886:Tacc2 UTSW 7 130729120 missense probably benign 0.18
R5996:Tacc2 UTSW 7 130623483 missense probably damaging 0.96
R6074:Tacc2 UTSW 7 130625435 missense possibly damaging 0.92
R6127:Tacc2 UTSW 7 130626115 missense possibly damaging 0.92
R6156:Tacc2 UTSW 7 130625764 missense probably damaging 0.98
R6298:Tacc2 UTSW 7 130626525 missense probably benign 0.26
R6444:Tacc2 UTSW 7 130623412 missense possibly damaging 0.46
R6533:Tacc2 UTSW 7 130622837 missense possibly damaging 0.94
R6724:Tacc2 UTSW 7 130728762 missense probably damaging 1.00
X0010:Tacc2 UTSW 7 130735057 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGTCACTCCCTGAAATCAACC -3'
(R):5'- TTCTCCAAGGCAAGGTGTGG -3'

Sequencing Primer
(F):5'- TTTCCTTGAGAGGCCCCGTG -3'
(R):5'- CAAGGCAAGGTGTGGGTCTG -3'
Posted On2016-06-15