Incidental Mutation 'R5155:Mmp9'
ID396633
Institutional Source Beutler Lab
Gene Symbol Mmp9
Ensembl Gene ENSMUSG00000017737
Gene Namematrix metallopeptidase 9
Synonymsgelatinase B, MMP-9, Gelatinase B, B/MMP9, Gel B, Clg4b
MMRRC Submission 042737-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5155 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location164940780-164955850 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 164949066 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000017881 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017881] [ENSMUST00000137626]
Predicted Effect probably null
Transcript: ENSMUST00000017881
SMART Domains Protein: ENSMUSP00000017881
Gene: ENSMUSG00000017737

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:PG_binding_1 39 95 2.9e-8 PFAM
ZnMc 112 445 3.92e-39 SMART
FN2 223 271 8.08e-29 SMART
FN2 281 329 6.93e-28 SMART
FN2 340 388 9.28e-29 SMART
low complexity region 449 468 N/A INTRINSIC
Pfam:PT 474 508 1.1e-11 PFAM
HX 539 583 2.4e-8 SMART
HX 585 626 9.33e-6 SMART
HX 631 677 2.74e-3 SMART
HX 679 721 1.74e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134382
Predicted Effect probably benign
Transcript: ENSMUST00000137626
SMART Domains Protein: ENSMUSP00000120628
Gene: ENSMUSG00000017737

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
PDB:1L6J|A 20 67 5e-15 PDB
SCOP:d1l6ja1 29 67 2e-7 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the matrix metalloproteinase family of extracellular matrix-degrading enzymes that are involved in tissue remodeling, wound repair, progression of atherosclerosis and tumor invasion. The encoded preproprotein undergoes proteolytic processing to generate a mature, zinc-dependent endopeptidase enzyme that degrades collagens of type IV, V and XI, and elastin. Mice lacking the encoded protein exhibit an abnormal pattern of skeletal growth plate vascularization and ossification, reduced keratinocyte hyperproliferation at all neoplastic stages, a decreased incidence of invasive tumors, and resistance to experimental autoimmune encephalomyelitis. [provided by RefSeq, Feb 2016]
PHENOTYPE: Null mutants have short long bones with compensatory growth via delayed ossification and apoptosis of hypertrophic chondroctyes. Mutants are protected against ischemic brain injury, damage caused by myocardial infarction, and allergic airway inflammation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A830010M20Rik T C 5: 107,490,703 I323T probably damaging Het
Abca13 T C 11: 9,532,447 V4326A probably damaging Het
Actn4 A G 7: 28,962,017 probably null Het
Adamts8 A G 9: 30,954,548 D464G probably benign Het
Adssl1 T C 12: 112,638,208 I366T probably damaging Het
Alox12e T C 11: 70,316,255 D575G possibly damaging Het
Ankrd44 A T 1: 54,778,330 M73K probably benign Het
Ap4e1 A G 2: 127,063,369 T987A probably benign Het
Banp A C 8: 122,001,020 S318R probably damaging Het
Bcas1 T C 2: 170,418,618 H47R probably damaging Het
Brwd1 G T 16: 96,002,793 S2524* probably null Het
Cand2 T A 6: 115,792,258 D676E probably benign Het
Cc2d1a A T 8: 84,141,126 H224Q probably benign Het
Ccdc138 A T 10: 58,507,572 Y83F probably benign Het
Ccdc155 C A 7: 45,189,654 E53* probably null Het
Ccdc162 A T 10: 41,553,580 probably null Het
Ccdc162 A C 10: 41,579,151 S396A probably damaging Het
Ces1e A T 8: 93,201,406 *562R probably null Het
Clstn2 T A 9: 97,456,431 M892L probably benign Het
Crybg3 T C 16: 59,524,901 T2673A possibly damaging Het
Cstf3 A G 2: 104,652,485 N326S probably benign Het
Cux1 G A 5: 136,565,441 probably benign Het
Cyb5r4 T G 9: 87,040,403 M155R probably benign Het
D130043K22Rik A G 13: 24,872,290 D535G probably damaging Het
D430042O09Rik A G 7: 125,872,184 T1486A probably damaging Het
Dnah2 G A 11: 69,422,536 P4266S probably damaging Het
Dnah7a T A 1: 53,643,495 N272I probably benign Het
Dsg2 A G 18: 20,598,658 Y779C possibly damaging Het
Eif4g3 T A 4: 138,126,743 N507K probably benign Het
Elavl4 T C 4: 110,292,636 Q3R probably null Het
Engase T G 11: 118,481,281 I133S probably benign Het
Ercc5 T C 1: 44,180,622 V1018A probably damaging Het
Ext1 C A 15: 53,075,817 W612L probably damaging Het
Faap100 T A 11: 120,377,632 E105V possibly damaging Het
Fam8a1 G A 13: 46,673,562 A270T probably benign Het
Fhdc1 T G 3: 84,446,150 Q589H probably benign Het
Gatm G A 2: 122,609,853 T35I probably benign Het
Gcgr T C 11: 120,537,046 I271T probably benign Het
Gm21818 T C 13: 120,173,553 S124P probably benign Het
Gm527 T A 12: 64,923,607 Y239N probably damaging Het
H2-Ab1 A G 17: 34,267,384 H139R possibly damaging Het
Herc2 G A 7: 56,227,826 R4547Q possibly damaging Het
Itga1 A T 13: 115,035,303 S89T probably benign Het
Lrba A G 3: 86,351,300 M1365V probably benign Het
Lrp1b A C 2: 41,728,622 probably null Het
Map1a G A 2: 121,302,386 A990T probably damaging Het
Micall2 C A 5: 139,710,231 L784F probably damaging Het
Mrps7 T A 11: 115,604,829 Y64* probably null Het
Mslnl C T 17: 25,738,968 Q62* probably null Het
Nfil3 A G 13: 52,968,580 L96P probably damaging Het
Olfr453 A G 6: 42,744,814 Y259C probably damaging Het
Phf3 T C 1: 30,824,376 D756G possibly damaging Het
Plxnd1 C T 6: 115,958,988 probably null Het
Prickle4 C T 17: 47,690,057 probably null Het
Prr9 T A 3: 92,123,049 T95S possibly damaging Het
Prrc2a A G 17: 35,160,091 probably null Het
Prrt3 A G 6: 113,497,559 probably null Het
Psme4 A T 11: 30,876,806 Y1775F probably damaging Het
Pum2 T C 12: 8,713,572 V243A possibly damaging Het
Rnf32 T C 5: 29,203,147 S125P probably damaging Het
Rnf8 A G 17: 29,626,630 Y65C probably damaging Het
Rph3a T C 5: 120,948,770 T456A possibly damaging Het
Scaper T A 9: 55,556,086 Q854L probably null Het
Sez6l2 T C 7: 126,962,373 S472P probably damaging Het
Spsb3 T C 17: 24,886,995 probably benign Het
Srebf2 A G 15: 82,196,226 D40G probably damaging Het
Sspo A G 6: 48,460,474 N1389D probably benign Het
Taf4b G T 18: 14,830,095 A631S probably benign Het
Tigd4 G A 3: 84,594,663 V296M possibly damaging Het
Tsc22d2 T A 3: 58,417,316 probably benign Het
Uso1 T A 5: 92,167,335 probably null Het
Vmn2r6 T G 3: 64,538,514 N597H probably benign Het
Zfc3h1 T A 10: 115,412,121 S1076R possibly damaging Het
Zfp64 T A 2: 168,906,965 Q44L probably benign Het
Other mutations in Mmp9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01707:Mmp9 APN 2 164949989 missense probably benign 0.13
IGL01980:Mmp9 APN 2 164950916 missense probably benign 0.01
IGL02117:Mmp9 APN 2 164949724 missense probably damaging 1.00
IGL02515:Mmp9 APN 2 164948956 missense probably damaging 1.00
IGL02756:Mmp9 APN 2 164949315 missense probably benign 0.27
IGL02833:Mmp9 APN 2 164949803 missense probably damaging 1.00
IGL02893:Mmp9 APN 2 164949068 splice site probably null
IGL02949:Mmp9 APN 2 164951119 missense probably damaging 1.00
IGL03097:Mmp9 UTSW 2 164950806 intron probably null
R0001:Mmp9 UTSW 2 164948383 missense probably benign 0.02
R0125:Mmp9 UTSW 2 164951257 missense probably damaging 1.00
R0532:Mmp9 UTSW 2 164949820 nonsense probably null
R1300:Mmp9 UTSW 2 164948956 missense probably damaging 1.00
R1341:Mmp9 UTSW 2 164949327 missense probably damaging 1.00
R1366:Mmp9 UTSW 2 164953342 missense probably damaging 1.00
R1711:Mmp9 UTSW 2 164949422 missense probably damaging 1.00
R2138:Mmp9 UTSW 2 164952467 nonsense probably null
R3405:Mmp9 UTSW 2 164949390 missense probably damaging 0.99
R3406:Mmp9 UTSW 2 164949390 missense probably damaging 0.99
R4460:Mmp9 UTSW 2 164949038 missense probably damaging 0.99
R4655:Mmp9 UTSW 2 164951202 missense probably benign 0.29
R5309:Mmp9 UTSW 2 164950795 unclassified probably benign
R5355:Mmp9 UTSW 2 164950992 missense possibly damaging 0.76
R5476:Mmp9 UTSW 2 164952494 missense probably benign
R5505:Mmp9 UTSW 2 164953608 missense probably benign 0.34
R5646:Mmp9 UTSW 2 164949050 missense probably benign 0.00
R5725:Mmp9 UTSW 2 164949336 missense possibly damaging 0.93
R6968:Mmp9 UTSW 2 164952940 missense probably benign
R7082:Mmp9 UTSW 2 164948892 missense probably benign 0.25
X0020:Mmp9 UTSW 2 164950373 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCATACTTGTACCGCTATGG -3'
(R):5'- CATGCACGGATTACAAATGGGG -3'

Sequencing Primer
(F):5'- AGAAGCAGTCTCTACGGCC -3'
(R):5'- TTACAAATGGGGGTGGGC -3'
Posted On2016-06-21