Incidental Mutation 'R5155:Cux1'
ID396651
Institutional Source Beutler Lab
Gene Symbol Cux1
Ensembl Gene ENSMUSG00000029705
Gene Namecut-like homeobox 1
SynonymsCux-1, Cutl1, CDP, Cux
MMRRC Submission 042737-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.860) question?
Stock #R5155 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location136248135-136567490 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) G to A at 136565441 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000134819 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004097] [ENSMUST00000175918] [ENSMUST00000175975] [ENSMUST00000176172] [ENSMUST00000176216] [ENSMUST00000176745] [ENSMUST00000176778] [ENSMUST00000177297]
Predicted Effect probably benign
Transcript: ENSMUST00000004097
SMART Domains Protein: ENSMUSP00000004097
Gene: ENSMUSG00000029705

DomainStartEndE-ValueType
coiled coil region 16 45 N/A INTRINSIC
coiled coil region 110 365 N/A INTRINSIC
low complexity region 425 436 N/A INTRINSIC
CUT 452 538 5.06e-39 SMART
low complexity region 602 608 N/A INTRINSIC
low complexity region 620 642 N/A INTRINSIC
CUT 841 929 3.31e-43 SMART
low complexity region 956 972 N/A INTRINSIC
low complexity region 990 1011 N/A INTRINSIC
CUT 1024 1110 3.78e-38 SMART
HOX 1150 1212 6.32e-15 SMART
low complexity region 1224 1239 N/A INTRINSIC
low complexity region 1317 1379 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000175918
SMART Domains Protein: ENSMUSP00000135606
Gene: ENSMUSG00000029705

DomainStartEndE-ValueType
coiled coil region 73 328 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000175975
SMART Domains Protein: ENSMUSP00000135223
Gene: ENSMUSG00000029705

DomainStartEndE-ValueType
coiled coil region 1 169 N/A INTRINSIC
low complexity region 235 251 N/A INTRINSIC
low complexity region 277 289 N/A INTRINSIC
low complexity region 331 342 N/A INTRINSIC
CUT 358 444 5.06e-39 SMART
low complexity region 508 514 N/A INTRINSIC
low complexity region 526 548 N/A INTRINSIC
CUT 747 835 3.31e-43 SMART
low complexity region 862 878 N/A INTRINSIC
low complexity region 896 917 N/A INTRINSIC
CUT 930 1016 3.78e-38 SMART
HOX 1056 1118 6.32e-15 SMART
low complexity region 1130 1145 N/A INTRINSIC
low complexity region 1223 1285 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176172
SMART Domains Protein: ENSMUSP00000135086
Gene: ENSMUSG00000029705

DomainStartEndE-ValueType
coiled coil region 99 354 N/A INTRINSIC
low complexity region 420 436 N/A INTRINSIC
low complexity region 462 474 N/A INTRINSIC
low complexity region 516 527 N/A INTRINSIC
CUT 543 629 5.06e-39 SMART
low complexity region 693 699 N/A INTRINSIC
low complexity region 711 733 N/A INTRINSIC
CUT 932 1020 3.31e-43 SMART
low complexity region 1047 1063 N/A INTRINSIC
low complexity region 1081 1102 N/A INTRINSIC
CUT 1115 1201 3.78e-38 SMART
HOX 1241 1303 6.32e-15 SMART
low complexity region 1315 1330 N/A INTRINSIC
low complexity region 1408 1470 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176216
SMART Domains Protein: ENSMUSP00000135054
Gene: ENSMUSG00000029705

DomainStartEndE-ValueType
coiled coil region 16 45 N/A INTRINSIC
coiled coil region 110 365 N/A INTRINSIC
internal_repeat_1 369 390 9.35e-5 PROSPERO
Pfam:CASP_C 421 647 1.2e-71 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176501
Predicted Effect probably benign
Transcript: ENSMUST00000176745
SMART Domains Protein: ENSMUSP00000135512
Gene: ENSMUSG00000029705

DomainStartEndE-ValueType
coiled coil region 16 45 N/A INTRINSIC
coiled coil region 110 363 N/A INTRINSIC
internal_repeat_1 367 388 8.95e-5 PROSPERO
Pfam:CASP_C 419 645 1.2e-71 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000176778
AA Change: A86V
SMART Domains Protein: ENSMUSP00000135892
Gene: ENSMUSG00000029705
AA Change: A86V

DomainStartEndE-ValueType
low complexity region 78 86 N/A INTRINSIC
coiled coil region 195 448 N/A INTRINSIC
low complexity region 508 519 N/A INTRINSIC
CUT 535 621 5.06e-39 SMART
low complexity region 685 691 N/A INTRINSIC
low complexity region 703 725 N/A INTRINSIC
CUT 924 1012 3.31e-43 SMART
low complexity region 1039 1055 N/A INTRINSIC
low complexity region 1073 1094 N/A INTRINSIC
CUT 1107 1193 3.78e-38 SMART
HOX 1233 1295 6.32e-15 SMART
low complexity region 1307 1322 N/A INTRINSIC
low complexity region 1400 1462 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000177297
SMART Domains Protein: ENSMUSP00000134819
Gene: ENSMUSG00000029705

DomainStartEndE-ValueType
coiled coil region 16 45 N/A INTRINSIC
coiled coil region 110 365 N/A INTRINSIC
internal_repeat_1 369 390 8.99e-6 PROSPERO
Pfam:CASP_C 422 527 1.8e-17 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177305
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygotes for a targeted null mutation exhibit delayed lung development and neonatal mortality. Survivors show growth retardation and hair defects. Homozygotes for a partially deleted protein have curly hair, and females tend to lose their litters. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A830010M20Rik T C 5: 107,490,703 I323T probably damaging Het
Abca13 T C 11: 9,532,447 V4326A probably damaging Het
Actn4 A G 7: 28,962,017 probably null Het
Adamts8 A G 9: 30,954,548 D464G probably benign Het
Adssl1 T C 12: 112,638,208 I366T probably damaging Het
Alox12e T C 11: 70,316,255 D575G possibly damaging Het
Ankrd44 A T 1: 54,778,330 M73K probably benign Het
Ap4e1 A G 2: 127,063,369 T987A probably benign Het
Banp A C 8: 122,001,020 S318R probably damaging Het
Bcas1 T C 2: 170,418,618 H47R probably damaging Het
Brwd1 G T 16: 96,002,793 S2524* probably null Het
Cand2 T A 6: 115,792,258 D676E probably benign Het
Cc2d1a A T 8: 84,141,126 H224Q probably benign Het
Ccdc138 A T 10: 58,507,572 Y83F probably benign Het
Ccdc155 C A 7: 45,189,654 E53* probably null Het
Ccdc162 A T 10: 41,553,580 probably null Het
Ccdc162 A C 10: 41,579,151 S396A probably damaging Het
Ces1e A T 8: 93,201,406 *562R probably null Het
Clstn2 T A 9: 97,456,431 M892L probably benign Het
Crybg3 T C 16: 59,524,901 T2673A possibly damaging Het
Cstf3 A G 2: 104,652,485 N326S probably benign Het
Cyb5r4 T G 9: 87,040,403 M155R probably benign Het
D130043K22Rik A G 13: 24,872,290 D535G probably damaging Het
D430042O09Rik A G 7: 125,872,184 T1486A probably damaging Het
Dnah2 G A 11: 69,422,536 P4266S probably damaging Het
Dnah7a T A 1: 53,643,495 N272I probably benign Het
Dsg2 A G 18: 20,598,658 Y779C possibly damaging Het
Eif4g3 T A 4: 138,126,743 N507K probably benign Het
Elavl4 T C 4: 110,292,636 Q3R probably null Het
Engase T G 11: 118,481,281 I133S probably benign Het
Ercc5 T C 1: 44,180,622 V1018A probably damaging Het
Ext1 C A 15: 53,075,817 W612L probably damaging Het
Faap100 T A 11: 120,377,632 E105V possibly damaging Het
Fam8a1 G A 13: 46,673,562 A270T probably benign Het
Fhdc1 T G 3: 84,446,150 Q589H probably benign Het
Gatm G A 2: 122,609,853 T35I probably benign Het
Gcgr T C 11: 120,537,046 I271T probably benign Het
Gm21818 T C 13: 120,173,553 S124P probably benign Het
Gm527 T A 12: 64,923,607 Y239N probably damaging Het
H2-Ab1 A G 17: 34,267,384 H139R possibly damaging Het
Herc2 G A 7: 56,227,826 R4547Q possibly damaging Het
Itga1 A T 13: 115,035,303 S89T probably benign Het
Lrba A G 3: 86,351,300 M1365V probably benign Het
Lrp1b A C 2: 41,728,622 probably null Het
Map1a G A 2: 121,302,386 A990T probably damaging Het
Micall2 C A 5: 139,710,231 L784F probably damaging Het
Mmp9 T C 2: 164,949,066 probably null Het
Mrps7 T A 11: 115,604,829 Y64* probably null Het
Mslnl C T 17: 25,738,968 Q62* probably null Het
Nfil3 A G 13: 52,968,580 L96P probably damaging Het
Olfr453 A G 6: 42,744,814 Y259C probably damaging Het
Phf3 T C 1: 30,824,376 D756G possibly damaging Het
Plxnd1 C T 6: 115,958,988 probably null Het
Prickle4 C T 17: 47,690,057 probably null Het
Prr9 T A 3: 92,123,049 T95S possibly damaging Het
Prrc2a A G 17: 35,160,091 probably null Het
Prrt3 A G 6: 113,497,559 probably null Het
Psme4 A T 11: 30,876,806 Y1775F probably damaging Het
Pum2 T C 12: 8,713,572 V243A possibly damaging Het
Rnf32 T C 5: 29,203,147 S125P probably damaging Het
Rnf8 A G 17: 29,626,630 Y65C probably damaging Het
Rph3a T C 5: 120,948,770 T456A possibly damaging Het
Scaper T A 9: 55,556,086 Q854L probably null Het
Sez6l2 T C 7: 126,962,373 S472P probably damaging Het
Spsb3 T C 17: 24,886,995 probably benign Het
Srebf2 A G 15: 82,196,226 D40G probably damaging Het
Sspo A G 6: 48,460,474 N1389D probably benign Het
Taf4b G T 18: 14,830,095 A631S probably benign Het
Tigd4 G A 3: 84,594,663 V296M possibly damaging Het
Tsc22d2 T A 3: 58,417,316 probably benign Het
Uso1 T A 5: 92,167,335 probably null Het
Vmn2r6 T G 3: 64,538,514 N597H probably benign Het
Zfc3h1 T A 10: 115,412,121 S1076R possibly damaging Het
Zfp64 T A 2: 168,906,965 Q44L probably benign Het
Other mutations in Cux1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00846:Cux1 APN 5 136326796 missense probably damaging 1.00
IGL00966:Cux1 APN 5 136311491 intron probably benign
IGL01129:Cux1 APN 5 136304718 intron probably benign
IGL01885:Cux1 APN 5 136308447 missense possibly damaging 0.90
IGL01947:Cux1 APN 5 136275125 missense probably benign 0.04
IGL02259:Cux1 APN 5 136326833 missense probably damaging 1.00
IGL02666:Cux1 APN 5 136275315 nonsense probably null
IGL02826:Cux1 APN 5 136308003 missense probably damaging 1.00
IGL03014:Cux1 UTSW 5 136565525 intron probably benign
R0047:Cux1 UTSW 5 136363253 splice site probably benign
R0047:Cux1 UTSW 5 136363253 splice site probably benign
R0057:Cux1 UTSW 5 136256282 missense probably damaging 1.00
R0149:Cux1 UTSW 5 136279497 missense probably damaging 1.00
R0295:Cux1 UTSW 5 136313212 missense probably benign 0.04
R0361:Cux1 UTSW 5 136279497 missense probably damaging 1.00
R0533:Cux1 UTSW 5 136307859 missense probably damaging 1.00
R0630:Cux1 UTSW 5 136286835 missense probably damaging 1.00
R0801:Cux1 UTSW 5 136326929 missense probably damaging 0.97
R0884:Cux1 UTSW 5 136307835 missense probably damaging 1.00
R0976:Cux1 UTSW 5 136313290 missense probably damaging 1.00
R1073:Cux1 UTSW 5 136252541 critical splice donor site probably null
R1222:Cux1 UTSW 5 136275149 missense probably benign 0.18
R1518:Cux1 UTSW 5 136308279 missense probably benign 0.29
R1686:Cux1 UTSW 5 136275381 nonsense probably null
R1687:Cux1 UTSW 5 136312669 missense probably damaging 1.00
R1758:Cux1 UTSW 5 136392322 missense probably damaging 1.00
R1797:Cux1 UTSW 5 136275315 missense probably benign 0.22
R1919:Cux1 UTSW 5 136363319 nonsense probably null
R2051:Cux1 UTSW 5 136332658 missense probably damaging 1.00
R2339:Cux1 UTSW 5 136287008 missense probably damaging 1.00
R3438:Cux1 UTSW 5 136311560 missense probably damaging 0.97
R3713:Cux1 UTSW 5 136565543 intron probably benign
R3800:Cux1 UTSW 5 136316033 missense probably damaging 1.00
R3964:Cux1 UTSW 5 136282942 missense probably damaging 1.00
R4135:Cux1 UTSW 5 136307896 missense probably damaging 1.00
R4198:Cux1 UTSW 5 136286848 missense probably damaging 1.00
R4467:Cux1 UTSW 5 136312722 missense probably damaging 1.00
R4498:Cux1 UTSW 5 136312993 missense probably damaging 1.00
R4622:Cux1 UTSW 5 136308300 missense probably damaging 0.99
R4623:Cux1 UTSW 5 136308300 missense probably damaging 0.99
R4651:Cux1 UTSW 5 136567229 missense probably damaging 1.00
R4652:Cux1 UTSW 5 136567229 missense probably damaging 1.00
R4658:Cux1 UTSW 5 136250594 missense possibly damaging 0.80
R4665:Cux1 UTSW 5 136286799 missense probably damaging 1.00
R4704:Cux1 UTSW 5 136249201 missense probably benign 0.01
R4867:Cux1 UTSW 5 136274961 intron probably benign
R4965:Cux1 UTSW 5 136311556 missense possibly damaging 0.77
R5090:Cux1 UTSW 5 136313200 missense possibly damaging 0.95
R5226:Cux1 UTSW 5 136370173 missense probably benign 0.01
R5252:Cux1 UTSW 5 136308297 missense probably damaging 0.98
R5266:Cux1 UTSW 5 136312694 missense probably damaging 1.00
R5399:Cux1 UTSW 5 136252604 missense possibly damaging 0.58
R5509:Cux1 UTSW 5 136275317 missense probably benign 0.13
R5609:Cux1 UTSW 5 136392320 missense probably damaging 1.00
R5681:Cux1 UTSW 5 136308184 missense probably damaging 1.00
R5993:Cux1 UTSW 5 136363271 missense probably benign 0.00
R6049:Cux1 UTSW 5 136332710 missense probably damaging 1.00
R6290:Cux1 UTSW 5 136311558 missense probably damaging 0.99
R6310:Cux1 UTSW 5 136275164 missense probably benign 0.10
R6351:Cux1 UTSW 5 136309792 missense probably damaging 1.00
R6531:Cux1 UTSW 5 136275119 missense probably benign 0.03
R6590:Cux1 UTSW 5 136340117 missense probably damaging 0.99
R6663:Cux1 UTSW 5 136485847 missense probably damaging 1.00
R6690:Cux1 UTSW 5 136340117 missense probably damaging 0.99
R6777:Cux1 UTSW 5 136565568 intron probably benign
R6786:Cux1 UTSW 5 136567231 missense probably damaging 1.00
R6817:Cux1 UTSW 5 136373173 intron probably null
R6989:Cux1 UTSW 5 136279648 nonsense probably null
R7011:Cux1 UTSW 5 136360033 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCACACTTTAGAGTTGGGAGC -3'
(R):5'- ACTGATTGTGGTTCCTCGTC -3'

Sequencing Primer
(F):5'- CCCTAGAGATGTTATGGAAGATCAC -3'
(R):5'- GTGGTTCCTCGTCGCCTCG -3'
Posted On2016-06-21