Incidental Mutation 'R3406:Mmp9'
ID259371
Institutional Source Beutler Lab
Gene Symbol Mmp9
Ensembl Gene ENSMUSG00000017737
Gene Namematrix metallopeptidase 9
Synonymsgelatinase B, MMP-9, Gelatinase B, B/MMP9, Gel B, Clg4b
MMRRC Submission 040624-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3406 (G1)
Quality Score205
Status Validated
Chromosome2
Chromosomal Location164940780-164955850 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 164949390 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 160 (Y160C)
Ref Sequence ENSEMBL: ENSMUSP00000017881 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017881] [ENSMUST00000137626]
Predicted Effect probably damaging
Transcript: ENSMUST00000017881
AA Change: Y160C

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000017881
Gene: ENSMUSG00000017737
AA Change: Y160C

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:PG_binding_1 39 95 2.9e-8 PFAM
ZnMc 112 445 3.92e-39 SMART
FN2 223 271 8.08e-29 SMART
FN2 281 329 6.93e-28 SMART
FN2 340 388 9.28e-29 SMART
low complexity region 449 468 N/A INTRINSIC
Pfam:PT 474 508 1.1e-11 PFAM
HX 539 583 2.4e-8 SMART
HX 585 626 9.33e-6 SMART
HX 631 677 2.74e-3 SMART
HX 679 721 1.74e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134382
Predicted Effect probably benign
Transcript: ENSMUST00000137626
SMART Domains Protein: ENSMUSP00000120628
Gene: ENSMUSG00000017737

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
PDB:1L6J|A 20 67 5e-15 PDB
SCOP:d1l6ja1 29 67 2e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144917
Meta Mutation Damage Score 0.104 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.4%
Validation Efficiency 98% (52/53)
MGI Phenotype FUNCTION: This gene encodes a member of the matrix metalloproteinase family of extracellular matrix-degrading enzymes that are involved in tissue remodeling, wound repair, progression of atherosclerosis and tumor invasion. The encoded preproprotein undergoes proteolytic processing to generate a mature, zinc-dependent endopeptidase enzyme that degrades collagens of type IV, V and XI, and elastin. Mice lacking the encoded protein exhibit an abnormal pattern of skeletal growth plate vascularization and ossification, reduced keratinocyte hyperproliferation at all neoplastic stages, a decreased incidence of invasive tumors, and resistance to experimental autoimmune encephalomyelitis. [provided by RefSeq, Feb 2016]
PHENOTYPE: Null mutants have short long bones with compensatory growth via delayed ossification and apoptosis of hypertrophic chondroctyes. Mutants are protected against ischemic brain injury, damage caused by myocardial infarction, and allergic airway inflammation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd18 T A 3: 40,904,903 M1K probably null Het
Bdkrb2 T C 12: 105,592,496 V332A possibly damaging Het
Cdc27 T C 11: 104,507,200 E778G probably damaging Het
Chd4 C A 6: 125,122,007 T1586K probably benign Het
Cnga3 A G 1: 37,262,065 E622G probably benign Het
Dbh A G 2: 27,174,965 D396G possibly damaging Het
Dhodh G A 8: 109,603,475 R86* probably null Het
Dpt A C 1: 164,796,931 E67A probably damaging Het
Eif2ak2 A G 17: 78,858,639 probably benign Het
Esp4 T A 17: 40,602,445 L68M possibly damaging Het
Exo1 A G 1: 175,905,970 K787E possibly damaging Het
Fbxo38 T C 18: 62,514,843 T875A probably damaging Het
Gm5346 A T 8: 43,626,052 C378* probably null Het
Gsdma T C 11: 98,673,138 probably benign Het
Hemk1 G A 9: 107,337,216 Q6* probably null Het
Hmcn2 C T 2: 31,433,272 probably benign Het
Hook2 A G 8: 84,993,984 probably benign Het
Irx3 A G 8: 91,798,927 S507P unknown Het
Kazn C A 4: 142,239,195 probably benign Het
Kcne4 C T 1: 78,817,971 A112V possibly damaging Het
Lamb1 C T 12: 31,287,529 R372C probably damaging Het
Lrrc30 A G 17: 67,632,180 L135P probably damaging Het
Lyst T A 13: 13,635,230 M495K possibly damaging Het
Mab21l3 C A 3: 101,823,531 V131F probably damaging Het
Mki67 T A 7: 135,707,475 T416S probably benign Het
Mlst8 A T 17: 24,478,125 M56K probably benign Het
Mslnl A G 17: 25,746,181 Y507C probably damaging Het
Muc6 G A 7: 141,638,400 S2120F possibly damaging Het
Myl12a A T 17: 70,994,742 M130K probably benign Het
Ncdn C T 4: 126,748,595 R423Q probably benign Het
Ncf2 A G 1: 152,825,947 probably benign Het
Nek8 G T 11: 78,170,746 S319* probably null Het
Olfr553 T C 7: 102,614,786 M68V possibly damaging Het
Olfr740 G A 14: 50,453,196 C48Y probably benign Het
Pcdh17 T A 14: 84,446,622 D176E probably damaging Het
Pcdhb15 C A 18: 37,475,389 A558E probably benign Het
Plrg1 T A 3: 83,071,219 W431R probably damaging Het
Rbfox3 T A 11: 118,496,457 Q277L possibly damaging Het
Rpgrip1 G A 14: 52,145,209 D600N possibly damaging Het
Siah3 A G 14: 75,525,981 D224G probably damaging Het
Slc22a6 T C 19: 8,621,311 L244P probably damaging Het
Stap2 A T 17: 55,997,511 W374R probably benign Het
Tbck T A 3: 132,727,084 N418K probably benign Het
Tcp11x2 T C X: 135,654,984 N474S probably damaging Het
Tenm3 A C 8: 48,228,555 V2680G probably damaging Het
Thada A T 17: 84,230,785 probably benign Het
Tlr6 C T 5: 64,953,429 V712M probably damaging Het
Tmem28 A G X: 99,845,503 I325V probably benign Het
Uvssa G T 5: 33,389,818 G243C probably damaging Het
Vwa8 T A 14: 79,164,220 probably benign Het
Znrf2 A T 6: 54,884,791 N229I probably damaging Het
Other mutations in Mmp9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01707:Mmp9 APN 2 164949989 missense probably benign 0.13
IGL01980:Mmp9 APN 2 164950916 missense probably benign 0.01
IGL02117:Mmp9 APN 2 164949724 missense probably damaging 1.00
IGL02515:Mmp9 APN 2 164948956 missense probably damaging 1.00
IGL02756:Mmp9 APN 2 164949315 missense probably benign 0.27
IGL02833:Mmp9 APN 2 164949803 missense probably damaging 1.00
IGL02893:Mmp9 APN 2 164949068 splice site probably null
IGL02949:Mmp9 APN 2 164951119 missense probably damaging 1.00
IGL03097:Mmp9 UTSW 2 164950806 intron probably null
R0001:Mmp9 UTSW 2 164948383 missense probably benign 0.02
R0125:Mmp9 UTSW 2 164951257 missense probably damaging 1.00
R0532:Mmp9 UTSW 2 164949820 nonsense probably null
R1300:Mmp9 UTSW 2 164948956 missense probably damaging 1.00
R1341:Mmp9 UTSW 2 164949327 missense probably damaging 1.00
R1366:Mmp9 UTSW 2 164953342 missense probably damaging 1.00
R1711:Mmp9 UTSW 2 164949422 missense probably damaging 1.00
R2138:Mmp9 UTSW 2 164952467 nonsense probably null
R3405:Mmp9 UTSW 2 164949390 missense probably damaging 0.99
R4460:Mmp9 UTSW 2 164949038 missense probably damaging 0.99
R4655:Mmp9 UTSW 2 164951202 missense probably benign 0.29
R5155:Mmp9 UTSW 2 164949066 critical splice donor site probably null
R5309:Mmp9 UTSW 2 164950795 unclassified probably benign
R5355:Mmp9 UTSW 2 164950992 missense possibly damaging 0.76
R5476:Mmp9 UTSW 2 164952494 missense probably benign
R5505:Mmp9 UTSW 2 164953608 missense probably benign 0.34
R5646:Mmp9 UTSW 2 164949050 missense probably benign 0.00
R5725:Mmp9 UTSW 2 164949336 missense possibly damaging 0.93
R6968:Mmp9 UTSW 2 164952940 missense probably benign
X0020:Mmp9 UTSW 2 164950373 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGCGATCGTGGTGTAGCTG -3'
(R):5'- TGAGAAGAGGTGACTGCGACTC -3'

Sequencing Primer
(F):5'- TGGTGTAGCTGCTGCCC -3'
(R):5'- AGGTGACTGCGACTCCAAAGC -3'
Posted On2015-01-23