Incidental Mutation 'R5237:Serpina10'
ID398562
Institutional Source Beutler Lab
Gene Symbol Serpina10
Ensembl Gene ENSMUSG00000061947
Gene Nameserine (or cysteine) peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 10
SynonymsPZI
MMRRC Submission 042808-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.064) question?
Stock #R5237 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location103614786-103631444 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 103628816 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 48 (Y48F)
Ref Sequence ENSEMBL: ENSMUSP00000113644 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044231] [ENSMUST00000121625]
Predicted Effect probably benign
Transcript: ENSMUST00000044231
AA Change: Y48F

PolyPhen 2 Score 0.390 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000048357
Gene: ENSMUSG00000061947
AA Change: Y48F

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
low complexity region 46 71 N/A INTRINSIC
SERPIN 88 445 2.79e-105 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000121625
AA Change: Y48F

PolyPhen 2 Score 0.390 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000113644
Gene: ENSMUSG00000061947
AA Change: Y48F

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
low complexity region 46 71 N/A INTRINSIC
SERPIN 88 391 3.12e-53 SMART
Meta Mutation Damage Score 0.1116 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.5%
Validation Efficiency 100% (76/76)
MGI Phenotype FUNCTION: The protein encoded by this gene is a member of the large serpin family of proteins, and is also known as serpin PZ-dependent protease inhibitor (ZPI or PZI). This protein is thought to play an important role in the regulation of coagulation. It directly inhibits factor XIa, and also inhibits factor Xa in the presence of calcium, phospholipids, and protein Z (PZ). Deficiencies in this gene lead to an increase in thrombosis. Alternative splicing results in multiple transcript variants that encode multiple protein isoforms. [provided by RefSeq, Aug 2014]
PHENOTYPE: Mice homozygous for a knock-out allele display a reduced survival rate, enhanced thrombosis after ferric chloride-induced carotid artery injury, and increased mortality from pulmonary thromboembolism following collagen/epinephrine infusion. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl4 G A 4: 144,623,280 W369* probably null Het
Adamts3 A T 5: 89,775,377 M190K probably benign Het
Adamtsl1 T C 4: 86,385,669 probably null Het
Adcy1 A T 11: 7,149,553 I678L probably benign Het
Agtrap A G 4: 148,082,360 S27P probably benign Het
Ankrd24 C A 10: 81,642,545 probably benign Het
Atg2a G T 19: 6,246,814 V383L probably benign Het
Ccdc40 T C 11: 119,259,976 V1105A probably benign Het
Cenpf A T 1: 189,659,533 S684T probably benign Het
Cog7 A G 7: 121,951,221 L360P probably damaging Het
Col12a1 T A 9: 79,700,262 Q428L probably benign Het
Col4a1 G A 8: 11,245,068 probably benign Het
Cpeb2 G A 5: 43,285,756 C930Y probably damaging Het
Cul9 T C 17: 46,543,467 D103G probably benign Het
Cyb5a T G 18: 84,871,564 F39L probably damaging Het
Cyp2d12 T A 15: 82,558,006 probably null Het
Dnah7a A C 1: 53,447,531 probably null Het
Efcab9 A T 11: 32,522,832 I205K probably benign Het
Ezh1 A G 11: 101,216,993 probably null Het
Galnt6 C A 15: 100,693,393 C610F probably damaging Het
Gata4 C T 14: 63,240,626 A175T probably benign Het
Gcc1 A T 6: 28,420,652 I222K probably benign Het
Gm13119 G T 4: 144,362,471 E120* probably null Het
Gm5591 T A 7: 38,522,207 H146L probably benign Het
H2-T23 C T 17: 36,030,366 probably null Het
Hmcn2 T A 2: 31,414,716 I3124N probably benign Het
Hsf2 C A 10: 57,506,221 D364E probably benign Het
Il15ra A G 2: 11,733,205 T250A possibly damaging Het
Large2 T C 2: 92,367,142 E372G probably benign Het
Map2 A G 1: 66,439,010 probably benign Het
Med24 T C 11: 98,710,783 Y524C probably damaging Het
Mfsd6l C A 11: 68,557,270 Q316K probably benign Het
Mroh6 T C 15: 75,885,991 T417A possibly damaging Het
Mymk T C 2: 27,062,188 *181W probably null Het
Nup210l A G 3: 90,180,198 T1093A probably benign Het
Olfr120 T A 17: 37,726,377 C118S probably damaging Het
Olfr692 A T 7: 105,369,306 K327* probably null Het
Olfr796 A G 10: 129,607,863 V206A probably benign Het
Olfr921 C T 9: 38,775,956 R234W probably damaging Het
Papola T C 12: 105,826,960 V513A probably benign Het
Pex26 T A 6: 121,185,847 L119Q probably damaging Het
Phldb2 T C 16: 45,747,886 I1219V probably damaging Het
Plch2 A G 4: 155,010,794 V64A probably benign Het
Plekho1 A G 3: 95,995,625 V24A probably damaging Het
Pon2 A C 6: 5,265,455 S311A probably benign Het
Rsrc2 T C 5: 123,739,582 probably benign Het
Selenov T C 7: 28,288,147 D295G probably damaging Het
Setbp1 T A 18: 78,856,975 D1159V possibly damaging Het
Setx C T 2: 29,146,983 T1160I probably benign Het
Sin3b A C 8: 72,733,343 probably null Het
Skint11 A G 4: 114,244,845 K352E possibly damaging Het
Slitrk5 T A 14: 111,681,686 V914E possibly damaging Het
Srgap1 A G 10: 121,807,883 Y633H probably damaging Het
Stard9 A G 2: 120,699,358 D2032G probably damaging Het
Sv2c G A 13: 95,981,883 T486I possibly damaging Het
Tesk1 T C 4: 43,447,100 F496S probably damaging Het
Tfg T A 16: 56,712,708 E29D possibly damaging Het
Tnc G A 4: 63,962,096 T2038I probably damaging Het
Tor4a T G 2: 25,194,964 N309T probably damaging Het
Trim69 A G 2: 122,173,340 T257A probably benign Het
Trpm6 C T 19: 18,813,464 A621V probably damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Vmn1r6 A C 6: 57,003,194 Q258H probably damaging Het
Vmn2r84 A G 10: 130,385,994 C786R probably damaging Het
Xylt2 T C 11: 94,667,127 D638G probably benign Het
Zfp934 A G 13: 62,517,838 C330R probably damaging Het
Other mutations in Serpina10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02261:Serpina10 APN 12 103616949 missense probably damaging 1.00
IGL02411:Serpina10 APN 12 103616943 missense possibly damaging 0.94
R0051:Serpina10 UTSW 12 103626897 intron probably benign
R0051:Serpina10 UTSW 12 103626897 intron probably benign
R0526:Serpina10 UTSW 12 103616868 missense probably damaging 1.00
R1387:Serpina10 UTSW 12 103628241 missense probably benign
R1986:Serpina10 UTSW 12 103628255 missense possibly damaging 0.95
R2277:Serpina10 UTSW 12 103626743 missense probably benign 0.13
R4227:Serpina10 UTSW 12 103628415 missense probably damaging 0.99
R5506:Serpina10 UTSW 12 103626661 missense probably damaging 1.00
R6144:Serpina10 UTSW 12 103628833 missense probably benign 0.01
R6726:Serpina10 UTSW 12 103628369 missense probably benign 0.40
R6819:Serpina10 UTSW 12 103628360 missense probably benign 0.05
R7351:Serpina10 UTSW 12 103628935 missense probably benign
Y4337:Serpina10 UTSW 12 103624476 missense probably benign 0.17
Predicted Primers PCR Primer
(F):5'- AGCATCAAATTCACCATGGC -3'
(R):5'- CTCTGCCTAGGATGAAGGGAAG -3'

Sequencing Primer
(F):5'- TTCACCATGGCCACAGACAGG -3'
(R):5'- CCTAGGATGAAGGGAAGTGGCC -3'
Posted On2016-07-06