Incidental Mutation 'R5171:Ifi214'
List |< first << previous [record 20 of 47] next >> last >|
ID398671
Institutional Source Beutler Lab
Gene Symbol Ifi214
Ensembl Gene ENSMUSG00000070501
Gene Nameinterferon activated gene 214
SynonymsPyhin-B, BC094916
MMRRC Submission 042751-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.086) question?
Stock #R5171 (G1)
Quality Score175
Status Validated
Chromosome1
Chromosomal Location173519717-173535957 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 173526634 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 157 (S157P)
Ref Sequence ENSEMBL: ENSMUSP00000087888 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090406] [ENSMUST00000097463] [ENSMUST00000139092]
Predicted Effect possibly damaging
Transcript: ENSMUST00000090406
AA Change: S157P

PolyPhen 2 Score 0.930 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000087888
Gene: ENSMUSG00000070501
AA Change: S157P

DomainStartEndE-ValueType
PYRIN 6 83 5.01e-17 SMART
low complexity region 152 169 N/A INTRINSIC
Pfam:HIN 231 393 9.1e-71 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000097463
AA Change: S157P

PolyPhen 2 Score 0.734 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000095071
Gene: ENSMUSG00000070501
AA Change: S157P

DomainStartEndE-ValueType
PYRIN 6 83 5.01e-17 SMART
low complexity region 152 169 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000139092
AA Change: S157P

PolyPhen 2 Score 0.734 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000115105
Gene: ENSMUSG00000070501
AA Change: S157P

DomainStartEndE-ValueType
PYRIN 6 83 5.01e-17 SMART
low complexity region 152 169 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195022
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197288
Meta Mutation Damage Score 0.0604 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 100% (52/52)
MGI Phenotype FUNCTION: This gene encodes a protein that is a member of the PAAD/DAPIN/Pyrin domain family of proteins. However, compared to the related pyrin and HIN domain family, member 1 (Pyhin1) protein, this protein is C-terminally truncated and lacks a HIN domain, which has an unknown function. It is therefore possible that this gene represents a pseudogene of the Pyhin1 gene, but it is currently being retained as a functional protein-coding gene based on the presence of an intact PAAD/DAPIN/Pyrin domain. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AA986860 C A 1: 130,742,847 Q269K probably benign Het
Acad9 T A 3: 36,074,398 I136N possibly damaging Het
Adtrp A G 13: 41,777,563 S183P probably damaging Het
Atp11b C T 3: 35,832,937 T690I probably damaging Het
Bcl2l12 G A 7: 44,991,394 probably benign Het
Btnl7-ps T A 17: 34,533,529 noncoding transcript Het
Ccl12 T C 11: 82,102,634 C33R probably damaging Het
Cdc25a T A 9: 109,877,161 S57R probably benign Het
Coro2a T A 4: 46,542,372 probably benign Het
Cpne6 T C 14: 55,512,148 V55A possibly damaging Het
Ddn A G 15: 98,806,326 S362P possibly damaging Het
Dmpk C G 7: 19,088,019 L301V probably benign Het
Dnase1l1 C T X: 74,277,038 probably null Het
Donson A G 16: 91,681,293 V258A possibly damaging Het
Gm3336 G A 8: 70,721,875 V163I probably benign Het
Gm8765 A T 13: 50,700,378 T91S possibly damaging Het
Gper1 C T 5: 139,426,658 R253C probably damaging Het
Gpsm1 T A 2: 26,327,464 probably benign Het
Hip1 A G 5: 135,440,302 S251P probably damaging Het
Igkv4-80 A C 6: 69,016,665 S81A probably benign Het
Kntc1 T C 5: 123,799,844 V1535A probably benign Het
Mbd3l1 A G 9: 18,485,134 N185S probably benign Het
Mnx1 T C 5: 29,474,853 Q252R unknown Het
Mroh3 A T 1: 136,191,656 L463Q possibly damaging Het
Myom1 T C 17: 71,099,972 V1030A possibly damaging Het
Olfr1134 T G 2: 87,656,544 I126L possibly damaging Het
Olfr411 T C 11: 74,346,814 T257A probably benign Het
Olfr988 T C 2: 85,353,770 D52G probably benign Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Ranbp17 A G 11: 33,217,419 Y1015H probably benign Het
Rasal1 C T 5: 120,663,764 T256I probably benign Het
Rexo5 T A 7: 119,823,779 I278N probably damaging Het
Rims2 T A 15: 39,437,103 S77T probably damaging Het
Sdk2 C T 11: 113,850,982 A804T probably benign Het
Slc24a2 T A 4: 86,996,634 I589F probably benign Het
Slc25a38 T A 9: 120,122,115 I217K probably benign Het
Slc5a7 T C 17: 54,276,676 T529A probably benign Het
Spata22 T A 11: 73,336,208 S83T probably damaging Het
Stac2 A T 11: 98,043,498 C127S possibly damaging Het
Tep1 T C 14: 50,824,802 H2531R probably benign Het
Tmem151a G T 19: 5,082,033 R382S probably damaging Het
Trim60 T C 8: 65,000,524 T358A probably benign Het
Unc13c T A 9: 73,757,954 M1048L probably benign Het
Usp29 T C 7: 6,962,075 S306P probably damaging Het
Zfp26 T C 9: 20,444,907 K35R probably benign Het
Zfp462 T A 4: 55,016,986 probably null Het
Other mutations in Ifi214
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01413:Ifi214 APN 1 173529429 missense probably damaging 0.99
IGL01418:Ifi214 APN 1 173529429 missense probably damaging 0.99
IGL01821:Ifi214 APN 1 173529325 missense probably damaging 0.97
IGL03341:Ifi214 APN 1 173526516 missense possibly damaging 0.86
PIT4305001:Ifi214 UTSW 1 173527919 missense probably benign 0.00
R1908:Ifi214 UTSW 1 173529511 missense probably benign 0.44
R4239:Ifi214 UTSW 1 173524943 missense possibly damaging 0.92
R4731:Ifi214 UTSW 1 173526591 missense probably benign 0.26
R4732:Ifi214 UTSW 1 173526591 missense probably benign 0.26
R4733:Ifi214 UTSW 1 173526591 missense probably benign 0.26
R5531:Ifi214 UTSW 1 173525120 missense probably damaging 1.00
R6290:Ifi214 UTSW 1 173529417 missense probably damaging 1.00
R6499:Ifi214 UTSW 1 173525031 missense probably damaging 0.99
R7271:Ifi214 UTSW 1 173529476 missense probably damaging 0.96
R7290:Ifi214 UTSW 1 173529531 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- GTCCAAGGTTGCAATAGCCATC -3'
(R):5'- AGAGCCATCTTATATGTTTGCCAG -3'

Sequencing Primer
(F):5'- CAGAAAATTACCTTGGCTGGTG -3'
(R):5'- ATGTTTGCCAGAATCTGACTCATC -3'
Posted On2016-07-06