Incidental Mutation 'R5193:Cnn1'
ID399850
Institutional Source Beutler Lab
Gene Symbol Cnn1
Ensembl Gene ENSMUSG00000001349
Gene Namecalponin 1
Synonymscalponin h1, CN, CnnI
MMRRC Submission 042769-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5193 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location22099216-22109630 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 22107836 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 196 (D196V)
Ref Sequence ENSEMBL: ENSMUSP00000001384 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001384] [ENSMUST00000213607] [ENSMUST00000214601] [ENSMUST00000216872]
Predicted Effect probably damaging
Transcript: ENSMUST00000001384
AA Change: D196V

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000001384
Gene: ENSMUSG00000001349
AA Change: D196V

DomainStartEndE-ValueType
CH 30 127 2.69e-25 SMART
low complexity region 134 143 N/A INTRINSIC
Pfam:Calponin 164 188 1.1e-18 PFAM
Pfam:Calponin 204 228 1.1e-17 PFAM
Pfam:Calponin 243 267 2.6e-15 PFAM
low complexity region 286 295 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000213607
Predicted Effect probably damaging
Transcript: ENSMUST00000214601
AA Change: D196V

PolyPhen 2 Score 0.962 (Sensitivity: 0.78; Specificity: 0.95)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216141
Predicted Effect possibly damaging
Transcript: ENSMUST00000216872
AA Change: D146V

PolyPhen 2 Score 0.468 (Sensitivity: 0.89; Specificity: 0.90)
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for an allele lacking exons 5-7 exhibit accelerated cartilage formation and ossification. As adults mutant animals have increased width of the long bones and accelerated bone fracture repair. Mice homozygous for an allele lacking intron 1exhibit preweaning lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd12 A T 2: 150,835,306 *56R probably null Het
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Arfgap3 C T 15: 83,332,697 A156T probably benign Het
Bpifc T C 10: 86,000,633 T3A probably benign Het
Ccdc7a T A 8: 128,988,797 I269L probably benign Het
Cd151 A G 7: 141,470,693 Y253C probably damaging Het
Cenpl C A 1: 161,083,467 S328* probably null Het
Cfl1 T A 19: 5,492,552 V20D probably damaging Het
Clec14a A G 12: 58,268,614 L74P probably damaging Het
Cst13 C A 2: 148,828,223 C104* probably null Het
Det1 A G 7: 78,843,554 V234A probably damaging Het
Efnb2 A G 8: 8,623,162 M165T probably damaging Het
Fbxo10 T A 4: 45,051,573 K339* probably null Het
Fnta A T 8: 26,011,218 probably null Het
Fsip2 A T 2: 82,982,994 Y3219F possibly damaging Het
Gm340 A G 19: 41,582,530 D54G probably damaging Het
Gprin2 C T 14: 34,194,875 V313M possibly damaging Het
Hars A G 18: 36,767,305 L448S possibly damaging Het
Hipk3 A G 2: 104,430,000 I1166T possibly damaging Het
Il31ra T C 13: 112,524,330 E602G probably benign Het
Kctd15 A G 7: 34,644,857 L123P probably damaging Het
Kif1bp T C 10: 62,559,396 D489G possibly damaging Het
Krt1 C A 15: 101,845,922 S631I unknown Het
Lancl1 T A 1: 67,021,014 Y84F probably benign Het
Mafa G T 15: 75,747,817 P36T unknown Het
Magi2 G A 5: 20,358,972 probably null Het
Mcm9 T A 10: 53,616,038 I396F probably damaging Het
Mrgprh T C 17: 12,877,055 F61L probably damaging Het
Olfr1 TAGCGGTCGTA T 11: 73,395,653 probably null Het
Olfr1 AGCGGTCGTAGGC AGC 11: 73,395,654 probably null Het
Olfr1141 A T 2: 87,753,104 D296E possibly damaging Het
Olfr1511 A G 14: 52,390,612 W54R probably benign Het
Olfr576 T A 7: 102,965,936 F279I possibly damaging Het
Pcsk5 T A 19: 17,564,810 T806S possibly damaging Het
Pigc T C 1: 161,970,896 I149T possibly damaging Het
Pou5f2 C A 13: 78,024,964 N8K probably benign Het
Pou6f2 T C 13: 18,125,544 probably benign Het
Prl3d2 T A 13: 27,122,329 M13K possibly damaging Het
Pzp T C 6: 128,502,334 N619D probably benign Het
Rnps1 G A 17: 24,418,543 S53N probably benign Het
Scaf8 C G 17: 3,190,165 A604G probably benign Het
Scn10a T C 9: 119,609,655 N1716S probably damaging Het
Slc17a2 A G 13: 23,819,862 probably null Het
Slc22a30 G A 19: 8,344,393 Q436* probably null Het
Syne2 A G 12: 76,094,420 D6102G probably damaging Het
Tbc1d16 A T 11: 119,158,820 D283E probably benign Het
Tet1 T C 10: 62,838,247 D1350G probably benign Het
Trpa1 A G 1: 14,875,917 Y997H possibly damaging Het
Tyro3 T C 2: 119,810,517 L494P probably damaging Het
Uba6 G T 5: 86,124,422 Q803K probably benign Het
Vgll2 T A 10: 52,027,992 L317Q possibly damaging Het
Wdr62 A T 7: 30,265,167 I384N probably damaging Het
Wdtc1 G A 4: 133,294,367 R619* probably null Het
Xkr6 A G 14: 63,818,907 D89G possibly damaging Het
Other mutations in Cnn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00157:Cnn1 APN 9 22099397 missense possibly damaging 0.95
IGL02206:Cnn1 APN 9 22104378 splice site probably benign
spring_rolls UTSW 9 22107869 missense probably damaging 1.00
R1076:Cnn1 UTSW 9 22107869 missense probably damaging 1.00
R1647:Cnn1 UTSW 9 22107854 missense probably damaging 0.99
R1898:Cnn1 UTSW 9 22101264 critical splice donor site probably null
R3522:Cnn1 UTSW 9 22099368 missense probably benign 0.01
R5343:Cnn1 UTSW 9 22105410 missense probably benign 0.41
R7172:Cnn1 UTSW 9 22105494 missense probably damaging 1.00
R7205:Cnn1 UTSW 9 22105782 critical splice donor site probably null
R7251:Cnn1 UTSW 9 22108217 missense unknown
Predicted Primers PCR Primer
(F):5'- AGGATTCCAGTTGACAGGATG -3'
(R):5'- AGACCTGGCTCAAAGATCTGC -3'

Sequencing Primer
(F):5'- TTGACAGGATGTGGGCCAC -3'
(R):5'- TCAAAGATCTGCCGCTTGG -3'
Posted On2016-07-06