Incidental Mutation 'R5431:Gpr152'
ID428076
Institutional Source Beutler Lab
Gene Symbol Gpr152
Ensembl Gene ENSMUSG00000044724
Gene NameG protein-coupled receptor 152
SynonymsA930009H15Rik, LOC269053
MMRRC Submission 042847-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.037) question?
Stock #R5431 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location4139799-4145738 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 4143747 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 429 (V429D)
Ref Sequence ENSEMBL: ENSMUSP00000094062 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000008893] [ENSMUST00000025761] [ENSMUST00000096338] [ENSMUST00000123874]
Predicted Effect probably benign
Transcript: ENSMUST00000008893
SMART Domains Protein: ENSMUSP00000008893
Gene: ENSMUSG00000024835

DomainStartEndE-ValueType
DUF1899 5 69 1.48e-37 SMART
WD40 68 111 2.1e-7 SMART
WD40 121 161 1.44e-5 SMART
WD40 164 204 4.08e-5 SMART
DUF1900 258 392 6.41e-88 SMART
coiled coil region 445 482 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000025761
SMART Domains Protein: ENSMUSP00000025761
Gene: ENSMUSG00000024842

DomainStartEndE-ValueType
low complexity region 45 67 N/A INTRINSIC
low complexity region 79 97 N/A INTRINSIC
EFh 129 157 1.08e-6 SMART
Blast:EFh 165 193 2e-7 BLAST
EFh 206 234 1.05e-4 SMART
EFh 243 271 1.55e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000096338
AA Change: V429D

PolyPhen 2 Score 0.209 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000094062
Gene: ENSMUSG00000044724
AA Change: V429D

DomainStartEndE-ValueType
Pfam:7tm_1 47 295 7e-19 PFAM
low complexity region 347 361 N/A INTRINSIC
low complexity region 419 433 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000123874
SMART Domains Protein: ENSMUSP00000118450
Gene: ENSMUSG00000024835

DomainStartEndE-ValueType
DUF1899 5 69 1.48e-37 SMART
WD40 68 111 2.1e-7 SMART
WD40 121 161 1.44e-5 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134194
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142878
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143613
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148733
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310061N02Rik T C 16: 88,707,538 S124G possibly damaging Het
4921539E11Rik T C 4: 103,270,848 T27A probably benign Het
Aspg T A 12: 112,123,412 N461K probably benign Het
B4galnt3 T A 6: 120,218,967 T300S probably damaging Het
BC035044 A G 6: 128,885,007 probably benign Het
Bmp5 C T 9: 75,893,709 P374S probably damaging Het
C330018D20Rik A T 18: 56,957,856 F78L probably benign Het
Cds2 T A 2: 132,302,170 S289T probably benign Het
Cerkl C T 2: 79,341,335 C393Y probably damaging Het
Ciita C T 16: 10,523,792 R1020C probably damaging Het
Dcaf13 C A 15: 39,123,224 D130E probably benign Het
Dnal4 C T 15: 79,762,447 G50R probably damaging Het
Elfn1 A G 5: 139,971,568 N109S probably damaging Het
Ep400 A G 5: 110,676,554 V2435A unknown Het
Fam178b T C 1: 36,632,485 E185G probably damaging Het
Fam227b C A 2: 126,126,931 L74F probably benign Het
Fam92b C A 8: 120,167,303 probably null Het
Fgfr4 G A 13: 55,156,651 V138I probably benign Het
Flnc A G 6: 29,456,384 I2161V possibly damaging Het
Frmd5 T C 2: 121,562,909 N235S probably damaging Het
Gad1-ps G A 10: 99,445,147 noncoding transcript Het
Ggt6 A G 11: 72,437,738 T355A possibly damaging Het
Gm14393 G A 2: 175,063,876 T41I probably damaging Het
Gpr151 A C 18: 42,578,867 S249A probably damaging Het
Grm7 G A 6: 111,358,426 M599I probably benign Het
Hdac4 T A 1: 91,972,790 R54* probably null Het
Ice1 A G 13: 70,592,650 L2146S probably damaging Het
Igfbpl1 C T 4: 45,815,588 V183I probably benign Het
Kel G A 6: 41,698,420 S299F probably benign Het
Kif14 T C 1: 136,496,695 I1016T possibly damaging Het
Lhx3 T C 2: 26,201,118 D395G probably damaging Het
Micu1 T C 10: 59,750,521 Y140H possibly damaging Het
Myt1l G A 12: 29,832,332 G509R unknown Het
Nbn C T 4: 15,986,593 H665Y probably benign Het
Pkhd1 G T 1: 20,117,836 T3416K probably benign Het
Plxnb1 T C 9: 109,100,772 F232S probably damaging Het
Pus7l T C 15: 94,529,486 N472D probably damaging Het
Rfx1 C T 8: 84,082,720 Q225* probably null Het
Rnase2a T C 14: 51,255,563 Y115C possibly damaging Het
Ryr1 T A 7: 29,109,812 D386V probably benign Het
Sfi1 A ATCTTCCCAAAGCCAGTGC 11: 3,153,384 probably benign Homo
Sgcz T A 8: 37,639,984 T125S probably damaging Het
Sntb1 C G 15: 55,642,795 G461R probably damaging Het
Syt2 A G 1: 134,740,957 S36G probably benign Het
Tcaf3 A G 6: 42,597,185 L31P probably damaging Het
Tenm3 C A 8: 48,367,377 E142* probably null Het
Tgfbr2 G T 9: 116,131,601 S94R probably damaging Het
Vmn2r12 A G 5: 109,091,818 I293T probably damaging Het
Wrap73 G A 4: 154,145,274 R34Q probably damaging Het
Zc3h14 A G 12: 98,780,065 D511G possibly damaging Het
Zcchc11 T A 4: 108,491,412 I297N probably damaging Het
Other mutations in Gpr152
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00493:Gpr152 APN 19 4143507 missense probably benign
IGL01400:Gpr152 APN 19 4143627 missense probably benign 0.33
IGL01538:Gpr152 APN 19 4142952 missense probably damaging 1.00
IGL02288:Gpr152 APN 19 4143695 missense probably benign
IGL02513:Gpr152 APN 19 4142844 missense probably damaging 1.00
IGL03335:Gpr152 APN 19 4143771 missense possibly damaging 0.69
R0318:Gpr152 UTSW 19 4143542 missense possibly damaging 0.73
R1216:Gpr152 UTSW 19 4143555 missense possibly damaging 0.86
R1936:Gpr152 UTSW 19 4142532 missense probably damaging 1.00
R2248:Gpr152 UTSW 19 4143806 missense probably benign 0.00
R3161:Gpr152 UTSW 19 4142714 missense probably benign 0.00
R4193:Gpr152 UTSW 19 4142907 missense probably damaging 1.00
R4719:Gpr152 UTSW 19 4143224 missense possibly damaging 0.92
R4852:Gpr152 UTSW 19 4143791 missense probably benign 0.00
R5014:Gpr152 UTSW 19 4143507 missense probably benign 0.00
R5381:Gpr152 UTSW 19 4142517 missense probably damaging 1.00
R5470:Gpr152 UTSW 19 4143129 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTCCAGCTACAGTCAGATTCTG -3'
(R):5'- CAGCTGGTCTGTCTAGGTTCTC -3'

Sequencing Primer
(F):5'- ACAGTCAGATTCTGTGGTCCAGC -3'
(R):5'- TCTAGGTTCTCAGGGGTCCCAG -3'
Posted On2016-09-01