Incidental Mutation 'R5493:Aldh18a1'
ID432215
Institutional Source Beutler Lab
Gene Symbol Aldh18a1
Ensembl Gene ENSMUSG00000025007
Gene Namealdehyde dehydrogenase 18 family, member A1
Synonyms2810433K04Rik, Pycs
MMRRC Submission 043054-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5493 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location40550257-40588463 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 40551290 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 747 (R747Q)
Ref Sequence ENSEMBL: ENSMUSP00000135426 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025979] [ENSMUST00000175967] [ENSMUST00000176939]
Predicted Effect probably damaging
Transcript: ENSMUST00000025979
AA Change: R749Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000025979
Gene: ENSMUSG00000025007
AA Change: R749Q

DomainStartEndE-ValueType
Pfam:AA_kinase 71 329 1e-41 PFAM
Pfam:Aldedh 350 659 3.9e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155613
Predicted Effect probably benign
Transcript: ENSMUST00000175967
SMART Domains Protein: ENSMUSP00000135419
Gene: ENSMUSG00000025007

DomainStartEndE-ValueType
PDB:2H5G|B 1 83 9e-52 PDB
SCOP:d1a4sa_ 11 95 1e-14 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000176939
AA Change: R747Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000135426
Gene: ENSMUSG00000025007
AA Change: R747Q

DomainStartEndE-ValueType
Pfam:AA_kinase 71 327 1.9e-39 PFAM
Pfam:Aldedh 351 665 3.4e-11 PFAM
Meta Mutation Damage Score 0.384 question?
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 97.3%
  • 10x: 95.1%
  • 20x: 90.4%
Validation Efficiency 99% (80/81)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the aldehyde dehydrogenase family and encodes a bifunctional ATP- and NADPH-dependent mitochondrial enzyme with both gamma-glutamyl kinase and gamma-glutamyl phosphate reductase activities. The encoded protein catalyzes the reduction of glutamate to delta1-pyrroline-5-carboxylate, a critical step in the de novo biosynthesis of proline, ornithine and arginine. Mutations in this gene lead to hyperammonemia, hypoornithinemia, hypocitrullinemia, hypoargininemia and hypoprolinemia and may be associated with neurodegeneration, cataracts and connective tissue diseases. Alternatively spliced transcript variants, encoding different isoforms, have been described for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2510009E07Rik A G 16: 21,653,243 S236P possibly damaging Het
A830018L16Rik C T 1: 11,545,207 R135C probably damaging Het
Agpat3 A G 10: 78,284,235 V155A possibly damaging Het
Aloxe3 A T 11: 69,128,617 R119* probably null Het
Asap1 A G 15: 64,130,151 V460A possibly damaging Het
Bicral C A 17: 46,801,694 R860L possibly damaging Het
Cd180 T A 13: 102,706,141 I565N probably benign Het
Cdk13 T C 13: 17,803,562 probably benign Het
Cdkn2d T C 9: 21,289,007 D156G probably benign Het
Clrn1 A G 3: 58,846,416 S175P probably damaging Het
Coro7 A G 16: 4,632,487 L535S probably damaging Het
Cse1l A G 2: 166,941,190 probably benign Het
Cyp2a12 T C 7: 27,029,125 L7P unknown Het
D130043K22Rik A G 13: 24,863,603 Y377C probably damaging Het
Dctn1 G T 6: 83,182,564 R8L possibly damaging Het
Duox2 T C 2: 122,281,496 Q1341R probably damaging Het
Eif2b3 A G 4: 117,086,722 D447G possibly damaging Het
Fbxw25 T C 9: 109,652,916 Y234C probably benign Het
Gcnt2 A G 13: 40,953,600 N315S possibly damaging Het
Gm20730 A T 6: 43,081,812 V22E possibly damaging Het
Gm4847 T A 1: 166,630,321 I488F probably damaging Het
Gm8994 C G 6: 136,329,557 R339G probably damaging Het
Gmds A T 13: 31,940,505 M290K probably benign Het
Gtf3c1 T C 7: 125,670,544 N699S probably damaging Het
Hk3 A G 13: 55,011,171 V479A probably damaging Het
Ifnlr1 G A 4: 135,705,566 V438M probably benign Het
Il12rb1 C A 8: 70,809,839 P26T probably benign Het
Il4i1 G T 7: 44,840,053 R414L possibly damaging Het
Ipo4 T C 14: 55,630,870 N490S probably benign Het
Kcnmb2 A G 3: 32,198,142 E164G probably damaging Het
Kcns1 G A 2: 164,167,979 L287F probably benign Het
Kdm1a ACC AC 4: 136,557,421 probably null Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Knl1 T A 2: 119,068,730 I304K probably damaging Het
Ksr2 G T 5: 117,708,110 V681F probably damaging Het
Lypd2 T C 15: 74,734,278 T4A probably benign Het
Man1a A G 10: 54,074,480 V182A probably benign Het
Olfr1364 A T 13: 21,573,872 C195S probably damaging Het
Olfr504 T C 7: 108,565,567 D76G probably benign Het
Olfr533 A T 7: 140,466,807 D202V probably damaging Het
Olfr561 A T 7: 102,775,108 R195W probably benign Het
Olfr70 A G 4: 43,696,225 F316S possibly damaging Het
Pcdha2 C A 18: 36,939,509 F64L probably damaging Het
Pgap3 G C 11: 98,390,714 F168L possibly damaging Het
Pip5k1b T C 19: 24,439,075 N16S probably benign Het
Ppip5k1 T A 2: 121,336,772 H41L probably damaging Het
Ppp1r9a A G 6: 5,159,702 R1080G probably damaging Het
Qrich2 A C 11: 116,445,948 probably null Het
Rbl2 C T 8: 91,115,819 P1034L probably damaging Het
Rbpjl GCC GC 2: 164,414,410 probably null Het
Rin2 A G 2: 145,860,709 S442G probably damaging Het
Rtca C T 3: 116,499,631 R71Q probably benign Het
Serpind1 A T 16: 17,340,038 N366I probably damaging Het
Shox2 C G 3: 66,981,463 G32R probably damaging Het
Sp3 T A 2: 72,938,122 N766Y probably damaging Het
Spag7 T A 11: 70,669,233 S17C probably null Het
Stk25 A T 1: 93,635,309 F7I probably benign Het
Tbx15 G A 3: 99,352,564 G584S probably benign Het
Tenm2 T C 11: 36,864,676 D165G probably benign Het
Tox2 C A 2: 163,204,729 S42* probably null Het
Vmn1r39 A G 6: 66,804,770 V188A probably damaging Het
Zbtb5 A T 4: 44,993,941 M481K probably benign Het
Zfp26 T C 9: 20,444,319 T56A possibly damaging Het
Zfp459 C A 13: 67,408,379 C195F probably damaging Het
Zfp703 C T 8: 26,979,205 P299L probably damaging Het
Zfp764 A G 7: 127,404,933 I342T probably benign Het
Zfp942 T C 17: 21,933,004 N7D probably null Het
Other mutations in Aldh18a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01020:Aldh18a1 APN 19 40569181 splice site probably benign
IGL02353:Aldh18a1 APN 19 40577920 missense probably damaging 0.98
IGL02360:Aldh18a1 APN 19 40577920 missense probably damaging 0.98
IGL02974:Aldh18a1 APN 19 40569084 missense probably damaging 0.96
IGL03295:Aldh18a1 APN 19 40562942 missense probably damaging 1.00
PIT4498001:Aldh18a1 UTSW 19 40574356 missense probably benign
R0267:Aldh18a1 UTSW 19 40573789 missense probably benign 0.25
R0498:Aldh18a1 UTSW 19 40574272 missense probably benign 0.29
R1140:Aldh18a1 UTSW 19 40574285 missense probably benign 0.01
R1142:Aldh18a1 UTSW 19 40551213 missense probably damaging 0.97
R1509:Aldh18a1 UTSW 19 40557483 missense probably damaging 0.98
R1640:Aldh18a1 UTSW 19 40585499 missense probably benign
R1721:Aldh18a1 UTSW 19 40564838 missense probably damaging 1.00
R3012:Aldh18a1 UTSW 19 40557691 nonsense probably null
R3085:Aldh18a1 UTSW 19 40574369 missense probably benign
R3815:Aldh18a1 UTSW 19 40570500 missense probably damaging 1.00
R3863:Aldh18a1 UTSW 19 40551314 missense probably damaging 1.00
R4156:Aldh18a1 UTSW 19 40551281 missense probably damaging 1.00
R5116:Aldh18a1 UTSW 19 40553505 missense probably benign
R5135:Aldh18a1 UTSW 19 40554817 intron probably benign
R5393:Aldh18a1 UTSW 19 40585567 missense probably benign 0.00
R5492:Aldh18a1 UTSW 19 40551290 missense probably damaging 1.00
R5494:Aldh18a1 UTSW 19 40551290 missense probably damaging 1.00
R5957:Aldh18a1 UTSW 19 40570537 nonsense probably null
R6255:Aldh18a1 UTSW 19 40580043 missense possibly damaging 0.93
R6320:Aldh18a1 UTSW 19 40570561 missense probably benign 0.44
R6358:Aldh18a1 UTSW 19 40577678 missense possibly damaging 0.83
R6379:Aldh18a1 UTSW 19 40577770 critical splice donor site probably null
R6785:Aldh18a1 UTSW 19 40568344 missense probably damaging 1.00
R7334:Aldh18a1 UTSW 19 40551252 missense probably damaging 1.00
R7549:Aldh18a1 UTSW 19 40564847 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTGGAGATCCTGGAGTAGC -3'
(R):5'- TGTAGTGACAGGACTCACCC -3'

Sequencing Primer
(F):5'- AGTAGCCTCCATGTGCCAGAC -3'
(R):5'- CCACAAGTGAGGACCGTCAG -3'
Posted On2016-10-05