Incidental Mutation 'R5493:Shox2'
ID432160
Institutional Source Beutler Lab
Gene Symbol Shox2
Ensembl Gene ENSMUSG00000027833
Gene Nameshort stature homeobox 2
SynonymsPrx3, 6330543G17Rik, Og12x
MMRRC Submission 043054-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5493 (G1)
Quality Score87
Status Validated
Chromosome3
Chromosomal Location66971727-66981771 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to G at 66981463 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Arginine at position 32 (G32R)
Ref Sequence ENSEMBL: ENSMUSP00000029422 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029422] [ENSMUST00000046542] [ENSMUST00000065047] [ENSMUST00000065074] [ENSMUST00000160504] [ENSMUST00000161726] [ENSMUST00000162036] [ENSMUST00000162060] [ENSMUST00000162362] [ENSMUST00000162439] [ENSMUST00000162693] [ENSMUST00000195261]
Predicted Effect probably damaging
Transcript: ENSMUST00000029422
AA Change: G32R

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000029422
Gene: ENSMUSG00000027833
AA Change: G32R

DomainStartEndE-ValueType
low complexity region 57 90 N/A INTRINSIC
HOX 140 202 1.8e-28 SMART
low complexity region 258 273 N/A INTRINSIC
Pfam:OAR 310 327 3.3e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000046542
SMART Domains Protein: ENSMUSP00000047077
Gene: ENSMUSG00000034544

DomainStartEndE-ValueType
low complexity region 3 116 N/A INTRINSIC
coiled coil region 138 191 N/A INTRINSIC
low complexity region 223 236 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000065047
SMART Domains Protein: ENSMUSP00000066967
Gene: ENSMUSG00000034544

DomainStartEndE-ValueType
low complexity region 3 109 N/A INTRINSIC
coiled coil region 122 175 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000065074
SMART Domains Protein: ENSMUSP00000066797
Gene: ENSMUSG00000034544

DomainStartEndE-ValueType
low complexity region 3 95 N/A INTRINSIC
low complexity region 98 159 N/A INTRINSIC
coiled coil region 180 233 N/A INTRINSIC
low complexity region 265 278 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000160504
SMART Domains Protein: ENSMUSP00000124925
Gene: ENSMUSG00000034544

DomainStartEndE-ValueType
low complexity region 3 59 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000161726
SMART Domains Protein: ENSMUSP00000124347
Gene: ENSMUSG00000034544

DomainStartEndE-ValueType
low complexity region 3 95 N/A INTRINSIC
low complexity region 98 159 N/A INTRINSIC
coiled coil region 180 233 N/A INTRINSIC
low complexity region 265 278 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000162036
SMART Domains Protein: ENSMUSP00000125468
Gene: ENSMUSG00000034544

DomainStartEndE-ValueType
low complexity region 3 95 N/A INTRINSIC
low complexity region 98 159 N/A INTRINSIC
coiled coil region 180 233 N/A INTRINSIC
low complexity region 265 278 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000162060
SMART Domains Protein: ENSMUSP00000125031
Gene: ENSMUSG00000027833

DomainStartEndE-ValueType
HOX 11 73 1.8e-28 SMART
low complexity region 117 132 N/A INTRINSIC
Pfam:OAR 167 187 9.7e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000162098
SMART Domains Protein: ENSMUSP00000123838
Gene: ENSMUSG00000027833

DomainStartEndE-ValueType
low complexity region 1 11 N/A INTRINSIC
HOX 61 123 1.8e-28 SMART
low complexity region 167 182 N/A INTRINSIC
Pfam:OAR 219 236 1e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000162362
SMART Domains Protein: ENSMUSP00000123699
Gene: ENSMUSG00000034544

DomainStartEndE-ValueType
low complexity region 3 59 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000162439
SMART Domains Protein: ENSMUSP00000124924
Gene: ENSMUSG00000027833

DomainStartEndE-ValueType
HOX 11 73 1.8e-28 SMART
low complexity region 117 132 N/A INTRINSIC
Pfam:OAR 167 187 9.7e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162620
Predicted Effect probably benign
Transcript: ENSMUST00000162693
SMART Domains Protein: ENSMUSP00000125547
Gene: ENSMUSG00000034544

DomainStartEndE-ValueType
low complexity region 3 88 N/A INTRINSIC
low complexity region 96 157 N/A INTRINSIC
coiled coil region 178 231 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000195261
SMART Domains Protein: ENSMUSP00000141625
Gene: ENSMUSG00000027833

DomainStartEndE-ValueType
HOX 11 73 9e-31 SMART
Meta Mutation Damage Score 0.304 question?
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 97.3%
  • 10x: 95.1%
  • 20x: 90.4%
Validation Efficiency 99% (80/81)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the homeobox family of genes that encode proteins containing a 60-amino acid residue motif that represents a DNA binding domain. Homeobox genes have been characterized extensively as transcriptional regulators involved in pattern formation in both invertebrate and vertebrate species. Several human genetic disorders are caused by aberrations in human homeobox genes. This locus represents a pseudoautosomal homeobox gene that is thought to be responsible for idiopathic short stature, and it is implicated in the short stature phenotype of Turner syndrome patients. This gene is considered to be a candidate gene for Cornelia de Lange syndrome. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2009]
PHENOTYPE: Homozygous null mice display incomplete penetrance of embryonic lethality during organogenesis and incomplete clefting of the anterior part of the palate. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2510009E07Rik A G 16: 21,653,243 S236P possibly damaging Het
A830018L16Rik C T 1: 11,545,207 R135C probably damaging Het
Agpat3 A G 10: 78,284,235 V155A possibly damaging Het
Aldh18a1 C T 19: 40,551,290 R747Q probably damaging Het
Aloxe3 A T 11: 69,128,617 R119* probably null Het
Asap1 A G 15: 64,130,151 V460A possibly damaging Het
Bicral C A 17: 46,801,694 R860L possibly damaging Het
Cd180 T A 13: 102,706,141 I565N probably benign Het
Cdk13 T C 13: 17,803,562 probably benign Het
Cdkn2d T C 9: 21,289,007 D156G probably benign Het
Clrn1 A G 3: 58,846,416 S175P probably damaging Het
Coro7 A G 16: 4,632,487 L535S probably damaging Het
Cse1l A G 2: 166,941,190 probably benign Het
Cyp2a12 T C 7: 27,029,125 L7P unknown Het
D130043K22Rik A G 13: 24,863,603 Y377C probably damaging Het
Dctn1 G T 6: 83,182,564 R8L possibly damaging Het
Duox2 T C 2: 122,281,496 Q1341R probably damaging Het
Eif2b3 A G 4: 117,086,722 D447G possibly damaging Het
Fbxw25 T C 9: 109,652,916 Y234C probably benign Het
Gcnt2 A G 13: 40,953,600 N315S possibly damaging Het
Gm20730 A T 6: 43,081,812 V22E possibly damaging Het
Gm4847 T A 1: 166,630,321 I488F probably damaging Het
Gm8994 C G 6: 136,329,557 R339G probably damaging Het
Gmds A T 13: 31,940,505 M290K probably benign Het
Gtf3c1 T C 7: 125,670,544 N699S probably damaging Het
Hk3 A G 13: 55,011,171 V479A probably damaging Het
Ifnlr1 G A 4: 135,705,566 V438M probably benign Het
Il12rb1 C A 8: 70,809,839 P26T probably benign Het
Il4i1 G T 7: 44,840,053 R414L possibly damaging Het
Ipo4 T C 14: 55,630,870 N490S probably benign Het
Kcnmb2 A G 3: 32,198,142 E164G probably damaging Het
Kcns1 G A 2: 164,167,979 L287F probably benign Het
Kdm1a ACC AC 4: 136,557,421 probably null Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Knl1 T A 2: 119,068,730 I304K probably damaging Het
Ksr2 G T 5: 117,708,110 V681F probably damaging Het
Lypd2 T C 15: 74,734,278 T4A probably benign Het
Man1a A G 10: 54,074,480 V182A probably benign Het
Olfr1364 A T 13: 21,573,872 C195S probably damaging Het
Olfr504 T C 7: 108,565,567 D76G probably benign Het
Olfr533 A T 7: 140,466,807 D202V probably damaging Het
Olfr561 A T 7: 102,775,108 R195W probably benign Het
Olfr70 A G 4: 43,696,225 F316S possibly damaging Het
Pcdha2 C A 18: 36,939,509 F64L probably damaging Het
Pgap3 G C 11: 98,390,714 F168L possibly damaging Het
Pip5k1b T C 19: 24,439,075 N16S probably benign Het
Ppip5k1 T A 2: 121,336,772 H41L probably damaging Het
Ppp1r9a A G 6: 5,159,702 R1080G probably damaging Het
Qrich2 A C 11: 116,445,948 probably null Het
Rbl2 C T 8: 91,115,819 P1034L probably damaging Het
Rbpjl GCC GC 2: 164,414,410 probably null Het
Rin2 A G 2: 145,860,709 S442G probably damaging Het
Rtca C T 3: 116,499,631 R71Q probably benign Het
Serpind1 A T 16: 17,340,038 N366I probably damaging Het
Sp3 T A 2: 72,938,122 N766Y probably damaging Het
Spag7 T A 11: 70,669,233 S17C probably null Het
Stk25 A T 1: 93,635,309 F7I probably benign Het
Tbx15 G A 3: 99,352,564 G584S probably benign Het
Tenm2 T C 11: 36,864,676 D165G probably benign Het
Tox2 C A 2: 163,204,729 S42* probably null Het
Vmn1r39 A G 6: 66,804,770 V188A probably damaging Het
Zbtb5 A T 4: 44,993,941 M481K probably benign Het
Zfp26 T C 9: 20,444,319 T56A possibly damaging Het
Zfp459 C A 13: 67,408,379 C195F probably damaging Het
Zfp703 C T 8: 26,979,205 P299L probably damaging Het
Zfp764 A G 7: 127,404,933 I342T probably benign Het
Zfp942 T C 17: 21,933,004 N7D probably null Het
Other mutations in Shox2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00334:Shox2 APN 3 66981441 missense possibly damaging 0.49
IGL00813:Shox2 APN 3 66975444 missense probably damaging 1.00
IGL01534:Shox2 APN 3 66978363 missense probably benign 0.01
IGL01583:Shox2 APN 3 66973771 unclassified probably benign
R0306:Shox2 UTSW 3 66973834 missense probably damaging 0.98
R0374:Shox2 UTSW 3 66973851 missense probably damaging 0.98
R0625:Shox2 UTSW 3 66981544 critical splice donor site probably null
R0774:Shox2 UTSW 3 66973811 missense probably damaging 1.00
R1102:Shox2 UTSW 3 66978295 missense probably damaging 1.00
R1192:Shox2 UTSW 3 66973910 nonsense probably null
R2354:Shox2 UTSW 3 66981489 missense possibly damaging 0.94
R2518:Shox2 UTSW 3 66978359 missense possibly damaging 0.83
R4163:Shox2 UTSW 3 66973771 unclassified probably benign
R4976:Shox2 UTSW 3 66973675 unclassified probably benign
R5423:Shox2 UTSW 3 66973754 unclassified probably benign
R6528:Shox2 UTSW 3 66981285 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ATCCCGGTATCTCCCAAAGC -3'
(R):5'- GAAGCATCAGTTCCCATTTCCC -3'

Sequencing Primer
(F):5'- ATGTCCAGCTCCCGGAC -3'
(R):5'- CTGCCCCATTGATGTGTTATTATTG -3'
Posted On2016-10-05