Incidental Mutation 'R5493:Stk25'
ID432147
Institutional Source Beutler Lab
Gene Symbol Stk25
Ensembl Gene ENSMUSG00000026277
Gene Nameserine/threonine kinase 25 (yeast)
Synonyms1500019J11Rik, SOK-1, Ste20-like, Ysk1
MMRRC Submission 043054-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5493 (G1)
Quality Score138
Status Validated
Chromosome1
Chromosomal Location93619751-93658659 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 93635309 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 7 (F7I)
Ref Sequence ENSEMBL: ENSMUSP00000140396 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027498] [ENSMUST00000133769] [ENSMUST00000186287]
Predicted Effect probably benign
Transcript: ENSMUST00000027498
AA Change: F7I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000027498
Gene: ENSMUSG00000026277
AA Change: F7I

DomainStartEndE-ValueType
S_TKc 20 270 2.92e-98 SMART
low complexity region 292 314 N/A INTRINSIC
PDB:3W8H|B 355 426 8e-43 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000133769
AA Change: F7I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000117765
Gene: ENSMUSG00000026277
AA Change: F7I

DomainStartEndE-ValueType
Pfam:Pkinase 20 233 1.7e-63 PFAM
Pfam:Pkinase_Tyr 20 233 2.1e-47 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151068
Predicted Effect probably benign
Transcript: ENSMUST00000186287
AA Change: F7I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000140396
Gene: ENSMUSG00000026277
AA Change: F7I

DomainStartEndE-ValueType
STYKc 20 107 1.9e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190971
Meta Mutation Damage Score 0.108 question?
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 97.3%
  • 10x: 95.1%
  • 20x: 90.4%
Validation Efficiency 99% (80/81)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the germinal centre kinase III (GCK III) subfamily of the sterile 20 superfamily of kinases. The encoded enzyme plays a role in serine-threonine liver kinase B1 (LKB1) signaling pathway to regulate neuronal polarization and morphology of the Golgi apparatus. The protein is translocated from the Golgi apparatus to the nucleus in response to chemical anoxia and plays a role in regulation of cell death. A pseudogene associated with this gene is located on chromosome 18. Multiple alternatively spliced transcript variants have been observed for this gene. [provided by RefSeq, Dec 2012]
PHENOTYPE: Germ line null mutants display normal cortical layers and neuronal migration. Acute loss of expression results in impaired neuronal migration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2510009E07Rik A G 16: 21,653,243 S236P possibly damaging Het
A830018L16Rik C T 1: 11,545,207 R135C probably damaging Het
Agpat3 A G 10: 78,284,235 V155A possibly damaging Het
Aldh18a1 C T 19: 40,551,290 R747Q probably damaging Het
Aloxe3 A T 11: 69,128,617 R119* probably null Het
Asap1 A G 15: 64,130,151 V460A possibly damaging Het
Bicral C A 17: 46,801,694 R860L possibly damaging Het
Cd180 T A 13: 102,706,141 I565N probably benign Het
Cdk13 T C 13: 17,803,562 probably benign Het
Cdkn2d T C 9: 21,289,007 D156G probably benign Het
Clrn1 A G 3: 58,846,416 S175P probably damaging Het
Coro7 A G 16: 4,632,487 L535S probably damaging Het
Cse1l A G 2: 166,941,190 probably benign Het
Cyp2a12 T C 7: 27,029,125 L7P unknown Het
D130043K22Rik A G 13: 24,863,603 Y377C probably damaging Het
Dctn1 G T 6: 83,182,564 R8L possibly damaging Het
Duox2 T C 2: 122,281,496 Q1341R probably damaging Het
Eif2b3 A G 4: 117,086,722 D447G possibly damaging Het
Fbxw25 T C 9: 109,652,916 Y234C probably benign Het
Gcnt2 A G 13: 40,953,600 N315S possibly damaging Het
Gm20730 A T 6: 43,081,812 V22E possibly damaging Het
Gm4847 T A 1: 166,630,321 I488F probably damaging Het
Gm8994 C G 6: 136,329,557 R339G probably damaging Het
Gmds A T 13: 31,940,505 M290K probably benign Het
Gtf3c1 T C 7: 125,670,544 N699S probably damaging Het
Hk3 A G 13: 55,011,171 V479A probably damaging Het
Ifnlr1 G A 4: 135,705,566 V438M probably benign Het
Il12rb1 C A 8: 70,809,839 P26T probably benign Het
Il4i1 G T 7: 44,840,053 R414L possibly damaging Het
Ipo4 T C 14: 55,630,870 N490S probably benign Het
Kcnmb2 A G 3: 32,198,142 E164G probably damaging Het
Kcns1 G A 2: 164,167,979 L287F probably benign Het
Kdm1a ACC AC 4: 136,557,421 probably null Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Knl1 T A 2: 119,068,730 I304K probably damaging Het
Ksr2 G T 5: 117,708,110 V681F probably damaging Het
Lypd2 T C 15: 74,734,278 T4A probably benign Het
Man1a A G 10: 54,074,480 V182A probably benign Het
Olfr1364 A T 13: 21,573,872 C195S probably damaging Het
Olfr504 T C 7: 108,565,567 D76G probably benign Het
Olfr533 A T 7: 140,466,807 D202V probably damaging Het
Olfr561 A T 7: 102,775,108 R195W probably benign Het
Olfr70 A G 4: 43,696,225 F316S possibly damaging Het
Pcdha2 C A 18: 36,939,509 F64L probably damaging Het
Pgap3 G C 11: 98,390,714 F168L possibly damaging Het
Pip5k1b T C 19: 24,439,075 N16S probably benign Het
Ppip5k1 T A 2: 121,336,772 H41L probably damaging Het
Ppp1r9a A G 6: 5,159,702 R1080G probably damaging Het
Qrich2 A C 11: 116,445,948 probably null Het
Rbl2 C T 8: 91,115,819 P1034L probably damaging Het
Rbpjl GCC GC 2: 164,414,410 probably null Het
Rin2 A G 2: 145,860,709 S442G probably damaging Het
Rtca C T 3: 116,499,631 R71Q probably benign Het
Serpind1 A T 16: 17,340,038 N366I probably damaging Het
Shox2 C G 3: 66,981,463 G32R probably damaging Het
Sp3 T A 2: 72,938,122 N766Y probably damaging Het
Spag7 T A 11: 70,669,233 S17C probably null Het
Tbx15 G A 3: 99,352,564 G584S probably benign Het
Tenm2 T C 11: 36,864,676 D165G probably benign Het
Tox2 C A 2: 163,204,729 S42* probably null Het
Vmn1r39 A G 6: 66,804,770 V188A probably damaging Het
Zbtb5 A T 4: 44,993,941 M481K probably benign Het
Zfp26 T C 9: 20,444,319 T56A possibly damaging Het
Zfp459 C A 13: 67,408,379 C195F probably damaging Het
Zfp703 C T 8: 26,979,205 P299L probably damaging Het
Zfp764 A G 7: 127,404,933 I342T probably benign Het
Zfp942 T C 17: 21,933,004 N7D probably null Het
Other mutations in Stk25
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01291:Stk25 APN 1 93623423 unclassified probably null
IGL02952:Stk25 APN 1 93626076 missense probably damaging 1.00
IGL03144:Stk25 APN 1 93629136 missense probably damaging 1.00
ANU05:Stk25 UTSW 1 93623423 unclassified probably null
IGL02980:Stk25 UTSW 1 93627668 missense probably damaging 1.00
PIT4531001:Stk25 UTSW 1 93624624 missense probably benign
R0240:Stk25 UTSW 1 93627060 missense probably damaging 1.00
R0240:Stk25 UTSW 1 93627060 missense probably damaging 1.00
R0555:Stk25 UTSW 1 93624591 missense probably benign 0.00
R1178:Stk25 UTSW 1 93623389 unclassified probably benign
R1406:Stk25 UTSW 1 93625153 unclassified probably benign
R1493:Stk25 UTSW 1 93625600 missense probably benign 0.04
R2875:Stk25 UTSW 1 93629251 missense possibly damaging 0.91
R4657:Stk25 UTSW 1 93625656 unclassified probably benign
R4668:Stk25 UTSW 1 93625483 missense probably damaging 1.00
R4686:Stk25 UTSW 1 93623420 unclassified probably null
R5089:Stk25 UTSW 1 93624608 missense probably benign 0.05
R6013:Stk25 UTSW 1 93625459 critical splice donor site probably null
X0063:Stk25 UTSW 1 93625961 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGAGTCCATCTTCTGGGAAG -3'
(R):5'- ACTCCTAGTCCCACAGAGCTTC -3'

Sequencing Primer
(F):5'- ATCTTCTGGGAAGGTGCTCC -3'
(R):5'- CGAATTGCGGTGTGAGCC -3'
Posted On2016-10-05