Incidental Mutation 'R5472:Vmn2r28'
ID433866
Institutional Source Beutler Lab
Gene Symbol Vmn2r28
Ensembl Gene ENSMUSG00000066820
Gene Namevomeronasal 2, receptor 28
SynonymsEG665255
MMRRC Submission 043033-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.094) question?
Stock #R5472 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location5479531-5493967 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) C to T at 5487944 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000083477 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086297]
Predicted Effect probably null
Transcript: ENSMUST00000086297
SMART Domains Protein: ENSMUSP00000083477
Gene: ENSMUSG00000066820

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 73 470 1.7e-26 PFAM
Pfam:NCD3G 512 565 9.8e-21 PFAM
Pfam:7tm_3 598 833 2.8e-56 PFAM
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 97.3%
  • 10x: 95.3%
  • 20x: 91.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap11 T C 14: 78,513,429 N506S probably benign Het
BC067074 A G 13: 113,319,169 D583G probably benign Het
Brinp3 A T 1: 146,901,459 H548L possibly damaging Het
Cacna1c A G 6: 118,638,446 V1328A possibly damaging Het
Carmil1 C T 13: 24,155,471 V47I probably damaging Het
Cdk2ap2 C A 19: 4,098,048 T76K probably benign Het
Col16a1 T C 4: 130,092,771 probably benign Het
Cxcr4 C A 1: 128,589,625 A100S probably damaging Het
Fancl G T 11: 26,469,677 C305F probably damaging Het
Gcnt2 T C 13: 40,953,579 V308A probably benign Het
Gm11733 A T 11: 117,484,496 I24L unknown Het
Gm765 A T 6: 98,238,276 C129S probably damaging Het
Gm973 A G 1: 59,628,287 probably null Het
Gm996 T C 2: 25,579,702 T66A probably benign Het
Heatr5b A T 17: 78,801,660 F1057I probably damaging Het
Ifi213 A T 1: 173,567,272 probably null Het
Ighv1-20 A T 12: 114,723,851 V91E probably damaging Het
Inhba A G 13: 16,026,786 E311G probably damaging Het
Irx3 G T 8: 91,799,480 probably null Het
Jag1 C A 2: 137,084,995 C948F probably damaging Het
Kcna2 T C 3: 107,105,309 I402T possibly damaging Het
Kcnh8 A T 17: 52,977,816 Q938L possibly damaging Het
Lrsam1 ACC AC 2: 32,945,858 probably null Het
Macf1 T C 4: 123,450,061 T2123A probably benign Het
Mdh1 A T 11: 21,559,786 N196K probably benign Het
Msh6 G A 17: 87,984,561 R248Q possibly damaging Het
Odf2l G T 3: 145,146,866 R457L probably benign Het
Olfr822 A T 10: 130,075,029 L206F probably damaging Het
Pphln1 T C 15: 93,488,975 V318A possibly damaging Het
Ppp1r12a C T 10: 108,240,112 T267I probably damaging Het
Pramef20 T C 4: 144,377,157 D133G probably benign Het
Prpf8 A C 11: 75,503,643 K1801N possibly damaging Het
Raf1 A G 6: 115,626,706 probably null Het
Rasal3 C A 17: 32,396,669 L374F probably damaging Het
S1pr3 T A 13: 51,419,647 V288D probably damaging Het
Setd7 G A 3: 51,521,465 P315S probably benign Het
Slx4 C T 16: 3,991,540 A364T probably benign Het
Sp7 G A 15: 102,359,314 T19I probably benign Het
Tlr9 T A 9: 106,224,313 C268S probably damaging Het
Tmem117 T A 15: 95,094,513 D351E possibly damaging Het
Tmem45b T A 9: 31,428,044 D211V possibly damaging Het
Tns3 A G 11: 8,451,092 S1069P probably benign Het
Tsnax A G 8: 125,015,762 I77V probably benign Het
Txndc5 G A 13: 38,513,125 L79F possibly damaging Het
Ube2q1 A G 3: 89,777,241 E14G probably benign Het
Vwde A T 6: 13,193,118 D407E probably benign Het
Wdr35 T A 12: 9,016,619 M749K probably benign Het
Zfp109 A T 7: 24,228,621 C462* probably null Het
Other mutations in Vmn2r28
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00095:Vmn2r28 APN 7 5488069 missense probably benign 0.12
IGL01061:Vmn2r28 APN 7 5488184 missense probably damaging 1.00
IGL01160:Vmn2r28 APN 7 5486478 missense probably damaging 0.99
IGL01335:Vmn2r28 APN 7 5481088 missense possibly damaging 0.67
IGL01532:Vmn2r28 APN 7 5486464 missense probably benign 0.16
IGL01791:Vmn2r28 APN 7 5488162 missense probably benign 0.00
IGL01875:Vmn2r28 APN 7 5481303 missense probably benign 0.30
IGL02161:Vmn2r28 APN 7 5488124 missense possibly damaging 0.88
IGL02499:Vmn2r28 APN 7 5490569 missense probably damaging 0.98
IGL02858:Vmn2r28 APN 7 5481004 missense probably damaging 0.99
IGL03061:Vmn2r28 APN 7 5484016 missense probably damaging 0.98
R0288:Vmn2r28 UTSW 7 5488021 missense probably damaging 1.00
R0361:Vmn2r28 UTSW 7 5493716 missense probably benign 0.00
R0396:Vmn2r28 UTSW 7 5488514 missense probably benign 0.05
R0480:Vmn2r28 UTSW 7 5490457 missense probably benign 0.00
R0485:Vmn2r28 UTSW 7 5488690 missense probably damaging 1.00
R0837:Vmn2r28 UTSW 7 5488027 missense probably damaging 0.99
R1282:Vmn2r28 UTSW 7 5481302 missense probably damaging 0.99
R1296:Vmn2r28 UTSW 7 5481545 missense possibly damaging 0.81
R1829:Vmn2r28 UTSW 7 5493811 missense probably benign
R1853:Vmn2r28 UTSW 7 5481247 nonsense probably null
R1869:Vmn2r28 UTSW 7 5486346 missense probably benign 0.00
R1887:Vmn2r28 UTSW 7 5488289 missense possibly damaging 0.90
R1961:Vmn2r28 UTSW 7 5481071 missense possibly damaging 0.85
R1998:Vmn2r28 UTSW 7 5488314 missense possibly damaging 0.87
R2392:Vmn2r28 UTSW 7 5484131 missense probably damaging 0.98
R2432:Vmn2r28 UTSW 7 5488702 missense probably damaging 0.99
R3055:Vmn2r28 UTSW 7 5481392 missense probably damaging 0.98
R3753:Vmn2r28 UTSW 7 5488027 missense probably damaging 0.99
R3877:Vmn2r28 UTSW 7 5488358 missense probably damaging 1.00
R4307:Vmn2r28 UTSW 7 5490708 missense probably damaging 0.99
R5023:Vmn2r28 UTSW 7 5486464 missense probably benign 0.16
R5057:Vmn2r28 UTSW 7 5486464 missense probably benign 0.16
R5083:Vmn2r28 UTSW 7 5480672 missense possibly damaging 0.77
R5427:Vmn2r28 UTSW 7 5486377 missense probably damaging 0.99
R5511:Vmn2r28 UTSW 7 5484012 missense possibly damaging 0.61
R5731:Vmn2r28 UTSW 7 5488669 missense probably benign 0.41
R6091:Vmn2r28 UTSW 7 5493791 missense possibly damaging 0.88
R6179:Vmn2r28 UTSW 7 5488004 nonsense probably null
R6276:Vmn2r28 UTSW 7 5490731 missense probably benign 0.01
R6441:Vmn2r28 UTSW 7 5488475 missense probably benign 0.00
R6463:Vmn2r28 UTSW 7 5486436 missense probably benign 0.07
R6528:Vmn2r28 UTSW 7 5490685 missense probably benign 0.12
R6725:Vmn2r28 UTSW 7 5488409 missense probably benign 0.13
R6760:Vmn2r28 UTSW 7 5481230 missense probably damaging 0.97
R6849:Vmn2r28 UTSW 7 5480807 missense probably damaging 1.00
R7110:Vmn2r28 UTSW 7 5490734 missense probably benign 0.06
R7146:Vmn2r28 UTSW 7 5481496 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- AAGGGTTGAGCTGACATCTGAATG -3'
(R):5'- GCTTCATTGGATTGGCTAATAGAACAG -3'

Sequencing Primer
(F):5'- AATCTGCGACTTCTTTTACCAATCAC -3'
(R):5'- TTGGCTAATAGAACAGAAGTTTGAC -3'
Posted On2016-10-06