Incidental Mutation 'R5472:Slx4'
ID433894
Institutional Source Beutler Lab
Gene Symbol Slx4
Ensembl Gene ENSMUSG00000039738
Gene NameSLX4 structure-specific endonuclease subunit homolog (S. cerevisiae)
SynonymsBtbd12, D16Bwg1016e
MMRRC Submission 043033-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5472 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location3979105-4003770 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 3991540 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 364 (A364T)
Ref Sequence ENSEMBL: ENSMUSP00000038871 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040790]
Predicted Effect probably benign
Transcript: ENSMUST00000040790
AA Change: A364T

PolyPhen 2 Score 0.132 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000038871
Gene: ENSMUSG00000039738
AA Change: A364T

DomainStartEndE-ValueType
low complexity region 400 413 N/A INTRINSIC
BTB 506 609 6.15e-7 SMART
low complexity region 651 667 N/A INTRINSIC
low complexity region 833 849 N/A INTRINSIC
low complexity region 857 875 N/A INTRINSIC
low complexity region 1176 1192 N/A INTRINSIC
low complexity region 1437 1461 N/A INTRINSIC
Pfam:Slx4 1484 1541 3e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000146569
SMART Domains Protein: ENSMUSP00000126423
Gene: ENSMUSG00000039738

DomainStartEndE-ValueType
Pfam:BTB 6 102 6.7e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000156542
Predicted Effect probably benign
Transcript: ENSMUST00000165830
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 97.3%
  • 10x: 95.3%
  • 20x: 91.3%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a protein containing a BTB (POZ) domain that comprises a subunit of structure-specific endonucleases. The encoded protein aids in the resolution of DNA secondary structures that arise during the processes of DNA repair and recombination. Knock out of this gene in mouse recapitulates the phenotype of the human disease Fanconi anemia, including blood cytopenia and susceptibility to genomic instability. [provided by RefSeq, Dec 2013]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit some preweaning lethality, reduced fertility, abnormal eye morphology, abnormal skeletal morphology, hydrocephalus, chromosomal instability, early cellular replicative senescence, and abnormal lymphopoeisis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap11 T C 14: 78,513,429 N506S probably benign Het
BC067074 A G 13: 113,319,169 D583G probably benign Het
Brinp3 A T 1: 146,901,459 H548L possibly damaging Het
Cacna1c A G 6: 118,638,446 V1328A possibly damaging Het
Carmil1 C T 13: 24,155,471 V47I probably damaging Het
Cdk2ap2 C A 19: 4,098,048 T76K probably benign Het
Col16a1 T C 4: 130,092,771 probably benign Het
Cxcr4 C A 1: 128,589,625 A100S probably damaging Het
Fancl G T 11: 26,469,677 C305F probably damaging Het
Gcnt2 T C 13: 40,953,579 V308A probably benign Het
Gm11733 A T 11: 117,484,496 I24L unknown Het
Gm765 A T 6: 98,238,276 C129S probably damaging Het
Gm973 A G 1: 59,628,287 probably null Het
Gm996 T C 2: 25,579,702 T66A probably benign Het
Heatr5b A T 17: 78,801,660 F1057I probably damaging Het
Ifi213 A T 1: 173,567,272 probably null Het
Ighv1-20 A T 12: 114,723,851 V91E probably damaging Het
Inhba A G 13: 16,026,786 E311G probably damaging Het
Irx3 G T 8: 91,799,480 probably null Het
Jag1 C A 2: 137,084,995 C948F probably damaging Het
Kcna2 T C 3: 107,105,309 I402T possibly damaging Het
Kcnh8 A T 17: 52,977,816 Q938L possibly damaging Het
Lrsam1 ACC AC 2: 32,945,858 probably null Het
Macf1 T C 4: 123,450,061 T2123A probably benign Het
Mdh1 A T 11: 21,559,786 N196K probably benign Het
Msh6 G A 17: 87,984,561 R248Q possibly damaging Het
Odf2l G T 3: 145,146,866 R457L probably benign Het
Olfr822 A T 10: 130,075,029 L206F probably damaging Het
Pphln1 T C 15: 93,488,975 V318A possibly damaging Het
Ppp1r12a C T 10: 108,240,112 T267I probably damaging Het
Pramef20 T C 4: 144,377,157 D133G probably benign Het
Prpf8 A C 11: 75,503,643 K1801N possibly damaging Het
Raf1 A G 6: 115,626,706 probably null Het
Rasal3 C A 17: 32,396,669 L374F probably damaging Het
S1pr3 T A 13: 51,419,647 V288D probably damaging Het
Setd7 G A 3: 51,521,465 P315S probably benign Het
Sp7 G A 15: 102,359,314 T19I probably benign Het
Tlr9 T A 9: 106,224,313 C268S probably damaging Het
Tmem117 T A 15: 95,094,513 D351E possibly damaging Het
Tmem45b T A 9: 31,428,044 D211V possibly damaging Het
Tns3 A G 11: 8,451,092 S1069P probably benign Het
Tsnax A G 8: 125,015,762 I77V probably benign Het
Txndc5 G A 13: 38,513,125 L79F possibly damaging Het
Ube2q1 A G 3: 89,777,241 E14G probably benign Het
Vmn2r28 C T 7: 5,487,944 probably null Het
Vwde A T 6: 13,193,118 D407E probably benign Het
Wdr35 T A 12: 9,016,619 M749K probably benign Het
Zfp109 A T 7: 24,228,621 C462* probably null Het
Other mutations in Slx4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01143:Slx4 APN 16 3990888 missense probably benign 0.17
IGL01767:Slx4 APN 16 3990248 missense probably benign 0.01
IGL02525:Slx4 APN 16 3980597 missense probably damaging 1.00
slim UTSW 16 3990910 nonsense probably null
R0033:Slx4 UTSW 16 3988000 missense probably benign 0.08
R0070:Slx4 UTSW 16 3988016 missense possibly damaging 0.71
R0070:Slx4 UTSW 16 3988016 missense possibly damaging 0.71
R0242:Slx4 UTSW 16 3986952 missense probably damaging 0.99
R0242:Slx4 UTSW 16 3986952 missense probably damaging 0.99
R0363:Slx4 UTSW 16 3980089 missense probably damaging 1.00
R0433:Slx4 UTSW 16 3986018 missense probably benign 0.01
R0993:Slx4 UTSW 16 3985825 missense probably benign 0.00
R1083:Slx4 UTSW 16 3990910 nonsense probably null
R1373:Slx4 UTSW 16 3985510 missense probably benign 0.02
R1710:Slx4 UTSW 16 3999158 missense probably benign 0.15
R1712:Slx4 UTSW 16 3991594 missense probably damaging 0.99
R1874:Slx4 UTSW 16 3986848 missense probably benign 0.25
R1937:Slx4 UTSW 16 3987166 makesense probably null
R2008:Slx4 UTSW 16 3979921 missense probably damaging 1.00
R2156:Slx4 UTSW 16 3986359 missense probably benign 0.00
R2427:Slx4 UTSW 16 3988987 missense probably damaging 0.99
R3765:Slx4 UTSW 16 3980986 missense probably damaging 1.00
R3890:Slx4 UTSW 16 3979909 missense probably damaging 1.00
R3891:Slx4 UTSW 16 3979909 missense probably damaging 1.00
R4465:Slx4 UTSW 16 3989055 missense possibly damaging 0.82
R4467:Slx4 UTSW 16 3989055 missense possibly damaging 0.82
R4497:Slx4 UTSW 16 3994909 missense probably damaging 1.00
R4882:Slx4 UTSW 16 3980996 critical splice acceptor site probably null
R5119:Slx4 UTSW 16 4001199 missense possibly damaging 0.89
R5384:Slx4 UTSW 16 3990805 missense probably damaging 1.00
R5578:Slx4 UTSW 16 3986862 missense probably damaging 1.00
R5582:Slx4 UTSW 16 3985788 missense possibly damaging 0.93
R5696:Slx4 UTSW 16 3979967 missense probably damaging 1.00
R5827:Slx4 UTSW 16 4001284 missense possibly damaging 0.94
R5964:Slx4 UTSW 16 4000951 critical splice donor site probably null
R6032:Slx4 UTSW 16 3980157 missense probably damaging 1.00
R6032:Slx4 UTSW 16 3980157 missense probably damaging 1.00
R6039:Slx4 UTSW 16 3986047 missense possibly damaging 0.82
R6039:Slx4 UTSW 16 3986047 missense possibly damaging 0.82
R6345:Slx4 UTSW 16 3990850 missense probably benign 0.06
R6612:Slx4 UTSW 16 3985276 missense probably damaging 0.99
R6979:Slx4 UTSW 16 3985015 missense probably damaging 0.96
R6989:Slx4 UTSW 16 3995838 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTACTAAGTTGCCACAGAGAC -3'
(R):5'- GACAGATTGAAGATCGTGTTGCC -3'

Sequencing Primer
(F):5'- TTGCCACAGAGACAATGCG -3'
(R):5'- GAAGATCGTGTTGCCCAGCTTC -3'
Posted On2016-10-06