Incidental Mutation 'R0006:Dnase2b'
ID43627
Institutional Source Beutler Lab
Gene Symbol Dnase2b
Ensembl Gene ENSMUSG00000028185
Gene Namedeoxyribonuclease II beta
SynonymsDlad, DnaseIIb
MMRRC Submission 041980-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.064) question?
Stock #R0006 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location146580985-146615596 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 146582489 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 284 (I284F)
Ref Sequence ENSEMBL: ENSMUSP00000142872 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029836] [ENSMUST00000199489] [ENSMUST00000200633]
Predicted Effect probably damaging
Transcript: ENSMUST00000029836
AA Change: I284F

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000029836
Gene: ENSMUSG00000028185
AA Change: I284F

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:DNase_II 27 353 1.5e-112 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000199489
SMART Domains Protein: ENSMUSP00000143418
Gene: ENSMUSG00000028186

DomainStartEndE-ValueType
Pfam:Uricase 1 121 8.3e-35 PFAM
Pfam:Uricase 128 228 1.8e-19 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000200633
AA Change: I284F

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000142872
Gene: ENSMUSG00000028185
AA Change: I284F

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:DNase_II 26 353 4.5e-117 PFAM
Meta Mutation Damage Score 0.28 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 93.3%
Validation Efficiency 97% (67/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene shares considerable sequence similarity to, and is structurally related to DNase II. The latter is a well characterized endonuclease that catalyzes DNA hydrolysis in the absence of divalent cations at acidic pH. Unlike DNase II which is ubiquitously expressed, expression of this gene product is restricted to the salivary gland and lungs. The gene has been localized to chromosome 1p22.3 adjacent (and in opposite orientation) to the uricase pseudogene. Two transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: The inability of homozygous mutant mice to degrade DNA in differentiating lens cells leads to cataract formation in the nucleus lentis. Consequently, mutant mice exhibit an impaired response to light. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aebp1 A G 11: 5,863,935 probably benign Het
Aldh3a1 G A 11: 61,217,101 V324M probably damaging Het
Als2cl T A 9: 110,894,618 L694Q possibly damaging Het
Appl2 A G 10: 83,602,898 F556L probably damaging Het
Atad2b T A 12: 4,942,030 S210T possibly damaging Het
Aurka A G 2: 172,359,753 probably null Het
Boc C T 16: 44,496,449 V444I probably benign Het
Ccdc109b A C 3: 129,933,765 probably benign Het
Cfap61 G A 2: 146,077,312 V655I probably benign Het
Chd8 A G 14: 52,235,293 I351T possibly damaging Het
Chid1 T A 7: 141,496,426 probably benign Het
Cyp3a41a T A 5: 145,704,796 H288L probably benign Het
Dock2 A G 11: 34,312,453 probably benign Het
Dst C T 1: 34,228,918 T5325I probably benign Het
Erbb3 A G 10: 128,573,410 probably null Het
Fam129c A G 8: 71,605,044 probably benign Het
Fancl A G 11: 26,469,695 N316S possibly damaging Het
Farsa G T 8: 84,861,305 probably benign Het
Fibcd1 T G 2: 31,838,587 D86A probably damaging Het
Gab1 A T 8: 80,769,730 M617K possibly damaging Het
Gabrd C A 4: 155,388,601 V72L probably damaging Het
Ggh C A 4: 20,054,155 T150K possibly damaging Het
Gm340 A G 19: 41,584,899 T698A probably benign Het
Gnb3 G A 6: 124,835,804 probably benign Het
Hephl1 T A 9: 15,076,764 T683S probably benign Het
Hmcn1 G A 1: 150,808,676 P381L probably damaging Het
Hspa8 T G 9: 40,804,629 N544K probably benign Het
Hspg2 C T 4: 137,519,931 T1155I probably damaging Het
Igdcc4 C T 9: 65,135,100 probably benign Het
Jazf1 A G 6: 52,894,086 probably benign Het
Kntc1 T A 5: 123,789,138 S1219T probably benign Het
L3mbtl1 A T 2: 162,964,569 Y460F possibly damaging Het
Lyrm7 T A 11: 54,848,597 T76S probably benign Het
Map1b C T 13: 99,435,302 V304M probably damaging Het
Muc13 T C 16: 33,803,148 S271P probably damaging Het
Myo16 A G 8: 10,475,988 K843E probably damaging Het
Nav2 A G 7: 49,453,230 E531G possibly damaging Het
Nup188 T C 2: 30,322,023 V553A probably benign Het
Olfr1 A G 11: 73,395,488 F178S probably damaging Het
Olfr1348 A G 7: 6,501,611 I205T possibly damaging Het
Olfr376 A G 11: 73,375,588 M283V possibly damaging Het
Olfr646 A G 7: 104,106,320 I14V probably benign Het
Olfr877 T A 9: 37,855,220 V134D possibly damaging Het
P4ha3 C T 7: 100,318,948 R378* probably null Het
Rap1gds1 G T 3: 138,983,871 probably null Het
Rbfox1 T A 16: 7,330,420 S244R probably benign Het
Rpp40 G A 13: 35,896,735 P339S probably damaging Het
Rsph4a T C 10: 33,909,148 C148R probably damaging Het
Skint5 T C 4: 113,893,862 probably benign Het
Sptbn1 A G 11: 30,123,855 S1405P probably damaging Het
Tex35 T C 1: 157,099,744 K154E possibly damaging Het
Thada T C 17: 84,226,040 N1661S probably benign Het
Tle4 A G 19: 14,466,714 probably benign Het
Tnxb T C 17: 34,682,292 S1027P probably benign Het
Tpm3 T A 3: 90,087,661 probably benign Het
Ubr4 T C 4: 139,431,649 F2438L probably benign Het
Uggt2 A T 14: 119,049,663 F640L probably benign Het
Vmn1r20 T G 6: 57,432,305 H205Q probably damaging Het
Wbp2 T C 11: 116,079,788 probably null Het
Xirp1 T C 9: 120,017,454 I788V probably benign Het
Zc3hav1 A G 6: 38,319,702 probably null Het
Zfp687 A G 3: 95,011,456 I335T probably damaging Het
Zfpm1 A G 8: 122,334,488 Y264C probably damaging Het
Other mutations in Dnase2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00725:Dnase2b APN 3 146596378 missense probably benign 0.34
IGL01626:Dnase2b APN 3 146584616 intron probably null
IGL02582:Dnase2b APN 3 146589085 missense probably benign 0.00
IGL02970:Dnase2b APN 3 146582506 missense probably damaging 0.97
R0006:Dnase2b UTSW 3 146582489 missense probably damaging 0.99
R0233:Dnase2b UTSW 3 146582550 missense probably benign 0.01
R0233:Dnase2b UTSW 3 146582550 missense probably benign 0.01
R0539:Dnase2b UTSW 3 146589155 splice site probably benign
R1544:Dnase2b UTSW 3 146584557 missense probably benign 0.03
R2201:Dnase2b UTSW 3 146584688 missense probably damaging 0.99
R3690:Dnase2b UTSW 3 146593571 nonsense probably null
R4921:Dnase2b UTSW 3 146593441 missense probably damaging 1.00
R5318:Dnase2b UTSW 3 146582455 missense probably benign 0.02
R6226:Dnase2b UTSW 3 146584563 missense probably benign
R6593:Dnase2b UTSW 3 146586911 missense probably damaging 1.00
R6781:Dnase2b UTSW 3 146582371 missense probably benign 0.40
R7035:Dnase2b UTSW 3 146582341 missense probably damaging 1.00
R7314:Dnase2b UTSW 3 146582396 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CCAGTGCCAGTGTTTTCAAGGACAG -3'
(R):5'- TTGCCAAGTGCATAGAGCCAGAG -3'

Sequencing Primer
(F):5'- GAGTTTACTTACAGAACCCATAACGG -3'
(R):5'- CCAGAGTGATTGGAGCTTTCTAC -3'
Posted On2013-05-29