Incidental Mutation 'R5618:Fez1'
ID439644
Institutional Source Beutler Lab
Gene Symbol Fez1
Ensembl Gene ENSMUSG00000032118
Gene Namefasciculation and elongation protein zeta 1 (zygin I)
SynonymsUNC-76, UNC76
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5618 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location36821864-36878924 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 36843932 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Tyrosine at position 76 (N76Y)
Ref Sequence ENSEMBL: ENSMUSP00000126072 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034630] [ENSMUST00000161500] [ENSMUST00000162633] [ENSMUST00000163816] [ENSMUST00000214772]
Predicted Effect probably damaging
Transcript: ENSMUST00000034630
AA Change: N76Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000034630
Gene: ENSMUSG00000032118
AA Change: N76Y

DomainStartEndE-ValueType
Pfam:FEZ 58 300 3.4e-96 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000160041
AA Change: N52Y
SMART Domains Protein: ENSMUSP00000124648
Gene: ENSMUSG00000032118
AA Change: N52Y

DomainStartEndE-ValueType
Pfam:FEZ 35 87 4.6e-19 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000161500
AA Change: N76Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000123762
Gene: ENSMUSG00000032118
AA Change: N76Y

DomainStartEndE-ValueType
Pfam:FEZ 58 167 5.6e-38 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000162633
AA Change: N76Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000124634
Gene: ENSMUSG00000032118
AA Change: N76Y

DomainStartEndE-ValueType
Pfam:FEZ 58 123 6.3e-29 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000163816
AA Change: N76Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000126072
Gene: ENSMUSG00000032118
AA Change: N76Y

DomainStartEndE-ValueType
Pfam:FEZ 58 297 2.7e-86 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000214772
AA Change: N76Y

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216539
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is an ortholog of the C. elegans unc-76 gene, which is necessary for normal axonal bundling and elongation within axon bundles. Expression of this gene in C. elegans unc-76 mutants can restore to the mutants partial locomotion and axonal fasciculation, suggesting that it also functions in axonal outgrowth. The N-terminal half of the gene product is highly acidic. Alternatively spliced transcript variants encoding different isoforms of this protein have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit hyperactivity and increased sensitivity to methamphetamine. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700028K03Rik G A 5: 107,548,199 W167* probably null Het
Acvr1 C T 2: 58,462,943 R335Q probably damaging Het
Atg7 A G 6: 114,673,699 D67G probably damaging Het
Avil T C 10: 127,010,577 F417S possibly damaging Het
AW551984 A T 9: 39,590,704 L702Q probably damaging Het
BC003965 G A 17: 25,184,989 S101N probably damaging Het
Bcl7a A T 5: 123,361,202 N95Y probably damaging Het
Cblb A G 16: 52,152,668 D454G possibly damaging Het
Cc2d2a A T 5: 43,729,907 Q1226H probably benign Het
Cct5 A G 15: 31,598,015 S13P possibly damaging Het
Clca1 C T 3: 145,004,977 E822K probably benign Het
Csgalnact2 A T 6: 118,126,316 D228E probably damaging Het
Defb12 A T 8: 19,114,798 M8K possibly damaging Het
Dysf A G 6: 84,106,824 D736G probably benign Het
Exog G T 9: 119,462,751 D365Y probably damaging Het
Fam222b T G 11: 78,154,240 V81G probably benign Het
Fam69b T C 2: 26,634,875 S96P probably damaging Het
Fbl A G 7: 28,178,986 E301G probably damaging Het
Gm13103 A T 4: 143,850,693 E15V possibly damaging Het
Gnb4 C T 3: 32,591,207 V112I probably benign Het
H2-Q4 T A 17: 35,379,925 F57Y probably damaging Het
Ift88 T C 14: 57,481,508 I650T possibly damaging Het
Kif1b A T 4: 149,269,889 D231E possibly damaging Het
Lig4 A T 8: 9,972,021 D586E probably benign Het
Mlc1 C A 15: 88,974,566 L126F probably damaging Het
Muc4 A G 16: 32,754,253 T1376A probably benign Het
Ncoa6 A T 2: 155,437,897 D66E possibly damaging Het
Olfr522 A G 7: 140,162,272 V226A probably damaging Het
Olfr907 C T 9: 38,498,740 Q24* probably null Het
Pard6a T C 8: 105,702,914 V168A probably damaging Het
Pmpcb A G 5: 21,742,788 N163S possibly damaging Het
Prdm2 C T 4: 143,133,537 C1061Y probably benign Het
Prkdc A G 16: 15,809,612 Y3378C probably damaging Het
Sema6a A T 18: 47,281,948 V425E probably damaging Het
Sema7a A T 9: 57,960,283 E439D possibly damaging Het
Serpinf1 T A 11: 75,410,184 T402S possibly damaging Het
Sf3a2 T C 10: 80,804,576 probably benign Het
Smchd1 A T 17: 71,455,727 D172E probably damaging Het
Spag5 T G 11: 78,304,080 I71S probably benign Het
Spata31d1d G A 13: 59,726,400 A1107V probably benign Het
Svep1 A C 4: 58,070,537 S2416R probably benign Het
Tbc1d9 A G 8: 83,242,592 Y503C probably damaging Het
Tlr9 A T 9: 106,224,739 I410F possibly damaging Het
Tmem87a C A 2: 120,369,306 L452F probably benign Het
Tmprss11d A T 5: 86,306,295 M217K probably benign Het
Ttc37 T A 13: 76,173,426 S1346T probably benign Het
Vmn2r80 T C 10: 79,148,921 Y36H probably benign Het
Vmn2r87 A T 10: 130,479,948 F83Y probably damaging Het
Vmp1 C T 11: 86,663,562 R75H probably benign Het
Wapl T A 14: 34,691,906 Y242N possibly damaging Het
Zfp473 T A 7: 44,741,732 D6V probably benign Het
Other mutations in Fez1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02540:Fez1 APN 9 36850399 missense probably damaging 0.97
R1280:Fez1 UTSW 9 36870549 frame shift probably null
R1458:Fez1 UTSW 9 36870549 frame shift probably null
R1741:Fez1 UTSW 9 36843733 missense probably damaging 1.00
R1846:Fez1 UTSW 9 36867767 missense probably damaging 1.00
R2072:Fez1 UTSW 9 36867945 missense probably benign 0.00
R4193:Fez1 UTSW 9 36843727 missense probably damaging 1.00
R4214:Fez1 UTSW 9 36870488 missense probably damaging 0.99
R4417:Fez1 UTSW 9 36870472 splice site probably benign
R4696:Fez1 UTSW 9 36870470 splice site probably null
R4735:Fez1 UTSW 9 36860845 nonsense probably null
R4947:Fez1 UTSW 9 36868875 missense probably damaging 0.99
R4950:Fez1 UTSW 9 36867882 missense probably damaging 1.00
R5538:Fez1 UTSW 9 36868876 missense probably damaging 1.00
R5742:Fez1 UTSW 9 36850447 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TATCAGGCCCAGTTGCACTG -3'
(R):5'- TGTTAGCTGTTACCGAGGTAC -3'

Sequencing Primer
(F):5'- GTTGCACTGAGGAGCCAG -3'
(R):5'- TTAGTCCAGTCCACGTAAACTCGTAG -3'
Posted On2016-11-08