Incidental Mutation 'R5669:Kcnk3'
ID442500
Institutional Source Beutler Lab
Gene Symbol Kcnk3
Ensembl Gene ENSMUSG00000049265
Gene Namepotassium channel, subfamily K, member 3
SynonymscTBAK-1, Task-1
MMRRC Submission 043312-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.119) question?
Stock #R5669 (G1)
Quality Score204
Status Not validated
Chromosome5
Chromosomal Location30588170-30625271 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 30622349 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 248 (T248A)
Ref Sequence ENSEMBL: ENSMUSP00000098987 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066295]
Predicted Effect probably damaging
Transcript: ENSMUST00000066295
AA Change: T248A

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000098987
Gene: ENSMUSG00000049265
AA Change: T248A

DomainStartEndE-ValueType
transmembrane domain 9 26 N/A INTRINSIC
low complexity region 37 49 N/A INTRINSIC
Pfam:Ion_trans_2 58 134 2.9e-20 PFAM
Pfam:Ion_trans_2 165 248 1.4e-21 PFAM
low complexity region 272 286 N/A INTRINSIC
low complexity region 296 308 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197428
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the superfamily of potassium channel proteins that contain two pore-forming P domains. The encoded protein is an outwardly rectifying channel that is sensitive to changes in extracellular pH and is inhibited by extracellular acidification. Also referred to as an acid-sensitive potassium channel, it is activated by the anesthetics halothane and isoflurane. Although three transcripts are detected in northern blots, there is currently no sequence available to confirm transcript variants for this gene. [provided by RefSeq, Aug 2008]
PHENOTYPE: Mice homozygous for a null alleles exhibit decreased pH sensitivitive of action potential in serotonergic neurons. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
Akap9 T A 5: 4,050,540 L2734* probably null Het
Aldh1a1 T C 19: 20,610,920 I25T probably damaging Het
Astl G T 2: 127,347,279 R175L probably damaging Het
BC035947 A T 1: 78,497,913 C661S probably damaging Het
Cd160 C T 3: 96,808,898 probably benign Het
Cdc42bpb C T 12: 111,302,013 probably null Het
Cdip1 T A 16: 4,768,815 I149F probably damaging Het
Cfap65 T C 1: 74,924,968 Y607C probably damaging Het
Col6a5 A G 9: 105,925,998 I1256T unknown Het
Copb1 A G 7: 114,237,585 V336A probably damaging Het
Ddx42 A T 11: 106,241,819 D556V probably damaging Het
Dlk1 T C 12: 109,460,038 V279A probably benign Het
Fbll1 T C 11: 35,797,584 N284S probably benign Het
Fbxw21 A T 9: 109,145,510 I314N probably benign Het
Foxa3 T C 7: 19,014,251 T317A probably benign Het
Gm14139 A G 2: 150,192,178 I140V probably benign Het
Gpr37 A T 6: 25,669,352 C498S probably benign Het
Hapln3 G T 7: 79,117,496 probably null Het
Igkv4-54 A G 6: 69,631,848 V29A possibly damaging Het
Itgb8 T A 12: 119,190,628 I225F probably damaging Het
Kcnv1 T C 15: 45,114,252 Q130R possibly damaging Het
Lrp1b T C 2: 41,111,038 H2058R probably damaging Het
Macf1 T A 4: 123,476,225 E1581V probably damaging Het
Mga A G 2: 119,903,426 N252D probably damaging Het
Nadsyn1 C T 7: 143,807,431 G335S probably damaging Het
Olfr1115 T C 2: 87,252,441 V168A probably benign Het
Olfr58 T C 9: 19,783,757 F208S probably benign Het
Pak7 G A 2: 136,116,284 P295S probably damaging Het
Pcsk1 T A 13: 75,130,102 S595T probably benign Het
Pepd T C 7: 35,040,674 V324A probably benign Het
Pml C T 9: 58,247,063 D176N probably benign Het
Popdc3 T A 10: 45,316,433 I163N probably damaging Het
Ppp1r13l A C 7: 19,373,022 T481P probably benign Het
Pramef12 T C 4: 144,395,843 I44V probably benign Het
Prlh A G 1: 90,953,120 T5A probably benign Het
Prom1 A G 5: 44,012,943 F638S possibly damaging Het
Prpf8 T A 11: 75,504,738 L1897H probably damaging Het
Ret T C 6: 118,184,243 T91A probably benign Het
Retsat A G 6: 72,606,010 S176G probably benign Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Rnf213 T C 11: 119,458,785 L3823P possibly damaging Het
Rnf31 C T 14: 55,596,704 A653V probably damaging Het
Rps6kl1 T C 12: 85,147,867 D90G probably damaging Het
Scarb1 A G 5: 125,300,387 Y194H probably damaging Het
Scube2 C T 7: 109,825,439 A556T probably benign Het
Serpinb1a A G 13: 32,845,316 L243P probably damaging Het
Slc39a4 A C 15: 76,614,163 L358R probably damaging Het
Slitrk5 A G 14: 111,681,623 D893G probably damaging Het
Srgap1 C A 10: 121,804,850 V681L probably benign Het
Tmprss6 A T 15: 78,454,956 M262K possibly damaging Het
Ttf2 T A 3: 100,951,117 K719* probably null Het
Vmn1r62 T A 7: 5,675,737 L139* probably null Het
Other mutations in Kcnk3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02481:Kcnk3 APN 5 30622383 missense probably damaging 0.99
IGL02719:Kcnk3 APN 5 30621980 missense probably damaging 1.00
PIT4802001:Kcnk3 UTSW 5 30622368 missense probably damaging 1.00
R0288:Kcnk3 UTSW 5 30588420 missense probably benign
R0834:Kcnk3 UTSW 5 30622635 missense probably damaging 1.00
R1740:Kcnk3 UTSW 5 30621977 missense possibly damaging 0.95
R2656:Kcnk3 UTSW 5 30622671 missense possibly damaging 0.55
R2923:Kcnk3 UTSW 5 30622070 missense probably damaging 1.00
R3740:Kcnk3 UTSW 5 30621930 missense possibly damaging 0.93
R4584:Kcnk3 UTSW 5 30588386 missense probably damaging 0.99
R5010:Kcnk3 UTSW 5 30622805 missense possibly damaging 0.79
R5070:Kcnk3 UTSW 5 30622386 missense possibly damaging 0.77
R5427:Kcnk3 UTSW 5 30622295 missense possibly damaging 0.86
R5956:Kcnk3 UTSW 5 30588510 missense probably damaging 1.00
R5982:Kcnk3 UTSW 5 30622670 missense probably benign 0.18
R5986:Kcnk3 UTSW 5 30588378 missense possibly damaging 0.68
R6318:Kcnk3 UTSW 5 30622586 missense probably damaging 0.98
R6860:Kcnk3 UTSW 5 30622053 missense possibly damaging 0.86
R6919:Kcnk3 UTSW 5 30622400 missense probably benign 0.00
R7350:Kcnk3 UTSW 5 30621966 missense probably damaging 1.00
R7418:Kcnk3 UTSW 5 30622331 missense possibly damaging 0.57
R7502:Kcnk3 UTSW 5 30622718 missense possibly damaging 0.85
Predicted Primers PCR Primer
(F):5'- ACGAGCGCTGGACTTTCTTC -3'
(R):5'- AGCACATGGACTGGAAGTGC -3'

Sequencing Primer
(F):5'- GGACTTTCTTCCAGGCCTATTAC -3'
(R):5'- AGCACCTCGGCATAGACGTTG -3'
Posted On2016-11-09