Incidental Mutation 'R5684:Dcbld2'
ID443250
Institutional Source Beutler Lab
Gene Symbol Dcbld2
Ensembl Gene ENSMUSG00000035107
Gene Namediscoidin, CUB and LCCL domain containing 2
SynonymsEsdn, 1700055P21Rik, CLCP1
MMRRC Submission 043178-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5684 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location58408443-58469727 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 58449809 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 278 (S278P)
Ref Sequence ENSEMBL: ENSMUSP00000039915 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046663]
Predicted Effect possibly damaging
Transcript: ENSMUST00000046663
AA Change: S278P

PolyPhen 2 Score 0.899 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000039915
Gene: ENSMUSG00000035107
AA Change: S278P

DomainStartEndE-ValueType
low complexity region 2 34 N/A INTRINSIC
CUB 69 184 4.26e-37 SMART
LCCL 188 273 4.74e-37 SMART
FA58C 288 446 4.08e-28 SMART
transmembrane domain 522 544 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.8%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced postnatal angiogenesis and impaired recovery from femoral artery ligation with impaired blood flow and decreased capillary density. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930519G04Rik A G 5: 114,879,560 D144G possibly damaging Het
4933406M09Rik A G 1: 134,389,922 D144G probably benign Het
AU040320 A G 4: 126,792,146 T172A probably benign Het
Bspry T C 4: 62,496,282 F371L possibly damaging Het
Cacna1c A G 6: 118,687,044 F555L probably damaging Het
Colec12 T C 18: 9,849,009 S396P probably damaging Het
Creb3l1 A G 2: 91,990,731 V336A probably damaging Het
Crocc T C 4: 141,051,144 N85S probably damaging Het
Dnhd1 G A 7: 105,703,209 R2523Q probably damaging Het
Ercc4 T A 16: 13,130,601 C561S probably benign Het
Gab1 T C 8: 80,769,670 K637R probably damaging Het
Grm5 T C 7: 88,130,645 S1130P probably benign Het
H2-M10.6 A T 17: 36,813,854 N221I probably damaging Het
Htr7 C A 19: 35,969,871 A248S probably damaging Het
Kcnh5 T A 12: 75,137,649 K100I probably damaging Het
Naip6 T A 13: 100,300,380 Q545L probably damaging Het
Nkpd1 C T 7: 19,523,573 Q276* probably null Het
Olfr159 T C 4: 43,770,624 N129S probably benign Het
Olfr487 A T 7: 108,212,072 Y152* probably null Het
Olfr488 A T 7: 108,256,039 I33N possibly damaging Het
Pidd1 A T 7: 141,441,111 probably null Het
Plec A G 15: 76,205,596 probably null Het
Plekhh2 C T 17: 84,597,918 A1080V probably damaging Het
Plppr3 A T 10: 79,865,317 S564T possibly damaging Het
Ppp2ca A G 11: 52,113,327 K104E probably damaging Het
Rad54l T A 4: 116,100,563 K407M probably damaging Het
Sfn T A 4: 133,601,292 K160* probably null Het
Slc22a15 A G 3: 101,862,955 S439P probably damaging Het
Slc6a2 T A 8: 92,989,053 V273D probably damaging Het
Slc9a9 T C 9: 95,055,508 F471S possibly damaging Het
Smc3 A G 19: 53,640,804 E896G probably benign Het
Sorbs3 C T 14: 70,181,222 R717Q probably damaging Het
Spg11 T C 2: 122,093,503 E779G probably damaging Het
Spg7 T C 8: 123,073,884 V66A probably damaging Het
Trmt11 A G 10: 30,547,710 S400P probably damaging Het
Trpc6 T C 9: 8,653,128 V567A probably damaging Het
Vmn2r103 T G 17: 19,792,989 I124S probably benign Het
Vps13a A T 19: 16,699,045 M1188K probably benign Het
Vtn G A 11: 78,500,558 G266S probably damaging Het
Yeats2 T C 16: 20,193,803 S640P possibly damaging Het
Zc3hav1 A T 6: 38,311,279 M874K probably benign Het
Other mutations in Dcbld2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01456:Dcbld2 APN 16 58408873 missense possibly damaging 0.75
IGL01978:Dcbld2 APN 16 58464319 missense probably benign 0.00
IGL02143:Dcbld2 APN 16 58448526 critical splice donor site probably null
IGL02953:Dcbld2 APN 16 58451737 missense probably benign 0.29
IGL03109:Dcbld2 APN 16 58456402 missense probably benign 0.06
IGL03131:Dcbld2 APN 16 58451688 missense probably benign 0.00
R0183:Dcbld2 UTSW 16 58445359 missense possibly damaging 0.70
R0305:Dcbld2 UTSW 16 58448939 missense probably damaging 1.00
R0316:Dcbld2 UTSW 16 58433445 missense probably damaging 1.00
R0371:Dcbld2 UTSW 16 58450823 missense probably benign 0.09
R0548:Dcbld2 UTSW 16 58455145 missense probably damaging 0.98
R0751:Dcbld2 UTSW 16 58449841 critical splice donor site probably null
R0906:Dcbld2 UTSW 16 58455247 missense probably damaging 1.00
R1184:Dcbld2 UTSW 16 58449841 critical splice donor site probably null
R1557:Dcbld2 UTSW 16 58465350 missense possibly damaging 0.49
R1995:Dcbld2 UTSW 16 58456332 missense probably benign
R3930:Dcbld2 UTSW 16 58465338 missense probably damaging 1.00
R3931:Dcbld2 UTSW 16 58465338 missense probably damaging 1.00
R4080:Dcbld2 UTSW 16 58465373 missense probably damaging 1.00
R4385:Dcbld2 UTSW 16 58463066 missense probably damaging 0.96
R4615:Dcbld2 UTSW 16 58456094 missense probably benign 0.03
R4739:Dcbld2 UTSW 16 58460976 missense probably damaging 1.00
R4963:Dcbld2 UTSW 16 58465782 missense probably benign
R4968:Dcbld2 UTSW 16 58424711 missense probably damaging 1.00
R5419:Dcbld2 UTSW 16 58455258 missense probably damaging 0.99
R5737:Dcbld2 UTSW 16 58460985 missense probably damaging 1.00
R6277:Dcbld2 UTSW 16 58451756 missense probably damaging 0.97
R6277:Dcbld2 UTSW 16 58465503 missense probably damaging 1.00
R6468:Dcbld2 UTSW 16 58433373 nonsense probably null
R6753:Dcbld2 UTSW 16 58456130 missense possibly damaging 0.94
R7213:Dcbld2 UTSW 16 58450763 missense probably benign 0.02
R7570:Dcbld2 UTSW 16 58424569 missense not run
Predicted Primers PCR Primer
(F):5'- GGCTCATTTTCTCCAAGGGAAATG -3'
(R):5'- AGGGCTCTATTTTACTCATGGCG -3'

Sequencing Primer
(F):5'- AATGCAGTAGCCAGCTCTG -3'
(R):5'- TACTCATGGCGTTCTCAAAAGC -3'
Posted On2016-11-09