Incidental Mutation 'R5754:Olfr1019'
ID444934
Institutional Source Beutler Lab
Gene Symbol Olfr1019
Ensembl Gene ENSMUSG00000075208
Gene Nameolfactory receptor 1019
SynonymsMOR180-1, GA_x6K02T2Q125-47320309-47319377
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.160) question?
Stock #R5754 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location85839621-85845483 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 85841312 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 160 (T160A)
Ref Sequence ENSEMBL: ENSMUSP00000150622 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102634] [ENSMUST00000213515]
Predicted Effect probably damaging
Transcript: ENSMUST00000102634
AA Change: T160A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099694
Gene: ENSMUSG00000075208
AA Change: T160A

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 1.7e-55 PFAM
Pfam:7TM_GPCR_Srsx 35 237 1.6e-6 PFAM
Pfam:7tm_1 41 290 1.4e-21 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000213515
AA Change: T160A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.158 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.8%
Validation Efficiency 98% (61/62)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik T C 11: 78,269,541 S609P probably damaging Het
Abcb4 T A 5: 8,934,320 N683K probably benign Het
Atad2b T A 12: 5,010,351 H915Q probably benign Het
Camk1d G T 2: 5,445,097 P91Q probably benign Het
Camk1d G C 2: 5,445,099 S90R probably damaging Het
Card11 T C 5: 140,899,769 E345G probably damaging Het
Ccdc58 A G 16: 36,085,057 N63S probably benign Het
Ccpg1 G T 9: 73,013,244 V714L possibly damaging Het
Chst9 T C 18: 15,453,197 E103G possibly damaging Het
Cnga1 C T 5: 72,605,272 V300I probably benign Het
Crb1 T C 1: 139,231,599 Y1295C probably damaging Het
Dnah5 A G 15: 28,401,868 T3392A probably benign Het
Elp3 C A 14: 65,547,990 R473L probably damaging Het
Epgn T A 5: 91,033,948 I145N probably benign Het
Fam107b G A 2: 3,778,420 G220D probably damaging Het
Fbn2 A G 18: 58,124,311 V328A probably benign Het
Fn1 A T 1: 71,600,322 I1770N probably damaging Het
Fndc1 T A 17: 7,769,753 Y1159F unknown Het
Frem2 A G 3: 53,537,258 L2484P probably damaging Het
Grk2 C T 19: 4,290,468 R295H probably damaging Het
Gtf3c1 A T 7: 125,644,065 V1789D possibly damaging Het
Hmgcl T C 4: 135,950,587 V33A probably damaging Het
Ighv7-1 A G 12: 113,896,619 F51S probably damaging Het
Kcna6 A G 6: 126,739,725 L67P probably damaging Het
Lamc1 A T 1: 153,247,284 V720E probably benign Het
Lrch1 T C 14: 74,817,118 D312G probably damaging Het
Nav2 A G 7: 49,557,046 T1540A probably damaging Het
Nisch A T 14: 31,191,416 probably benign Het
Nos1ap T A 1: 170,349,399 K145M probably damaging Het
Npc1l1 A G 11: 6,227,839 Y524H probably damaging Het
Nrap T C 19: 56,389,484 T25A possibly damaging Het
Nusap1 A G 2: 119,647,099 K363R probably damaging Het
Olfr1489 A G 19: 13,633,993 E294G probably damaging Het
Olfr873 T A 9: 20,301,094 L298Q probably damaging Het
Pde4d T C 13: 109,938,013 I384T probably damaging Het
Pkhd1 T A 1: 20,523,651 R1413* probably null Het
Plcd3 T A 11: 103,073,766 Y593F possibly damaging Het
Plxna1 A T 6: 89,333,105 I1026N possibly damaging Het
Podxl T A 6: 31,524,394 I409F probably damaging Het
Polq A C 16: 37,017,263 Q179P probably benign Het
Pomt1 T C 2: 32,247,590 V401A probably damaging Het
Qdpr C T 5: 45,439,385 G146S probably damaging Het
Shc4 T A 2: 125,670,298 Q2L probably damaging Het
Skint8 T A 4: 111,950,190 C358S probably benign Het
Smc5 T C 19: 23,244,103 E354G possibly damaging Het
Snx30 T C 4: 59,868,275 V129A probably damaging Het
Sp110 G C 1: 85,577,202 probably benign Het
Spag6 T A 2: 18,698,802 probably benign Het
Trim28 T A 7: 13,029,109 Y450N probably benign Het
Trip11 C T 12: 101,885,665 W428* probably null Het
Umodl1 T A 17: 30,994,787 V966E probably damaging Het
Utf1 A G 7: 139,944,791 probably benign Het
Vmn1r72 T C 7: 11,669,849 Y224C probably damaging Het
Whrn A G 4: 63,416,588 S748P probably damaging Het
Zbtb41 T A 1: 139,432,078 probably null Het
Zfhx3 T C 8: 108,800,332 F954L probably damaging Het
Zfp456 A T 13: 67,366,240 I449K probably benign Het
Other mutations in Olfr1019
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00309:Olfr1019 APN 2 85841362 missense probably benign 0.02
IGL02734:Olfr1019 APN 2 85841539 missense possibly damaging 0.88
IGL03030:Olfr1019 APN 2 85841072 missense probably damaging 1.00
IGL03207:Olfr1019 APN 2 85840973 missense probably benign 0.14
IGL03215:Olfr1019 APN 2 85841381 missense probably damaging 1.00
IGL03220:Olfr1019 APN 2 85840982 missense possibly damaging 0.87
R0441:Olfr1019 UTSW 2 85841515 missense probably damaging 1.00
R4013:Olfr1019 UTSW 2 85841381 missense probably damaging 1.00
R4604:Olfr1019 UTSW 2 85841182 missense probably damaging 0.99
R5307:Olfr1019 UTSW 2 85841014 missense probably damaging 1.00
R6010:Olfr1019 UTSW 2 85841561 missense probably benign 0.16
R6062:Olfr1019 UTSW 2 85841114 missense probably benign
R6103:Olfr1019 UTSW 2 85841432 missense probably damaging 1.00
R6443:Olfr1019 UTSW 2 85841635 missense probably damaging 0.99
R7442:Olfr1019 UTSW 2 85841752 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- GGCCTTCAGCTGATCGAATTC -3'
(R):5'- CCAGGATGCTGGCTGATTTTC -3'

Sequencing Primer
(F):5'- GCCTTCAGCTGATCGAATTCTGATG -3'
(R):5'- GCTGGCTGATTTTCTAACAAAGCAC -3'
Posted On2016-11-21