Incidental Mutation 'R5721:Prdm15'
ID451461
Institutional Source Beutler Lab
Gene Symbol Prdm15
Ensembl Gene ENSMUSG00000014039
Gene NamePR domain containing 15
SynonymsZfp298, E130018M06Rik
MMRRC Submission 043189-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.615) question?
Stock #R5721 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location97791467-97851850 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 97807096 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 667 (I667N)
Ref Sequence ENSEMBL: ENSMUSP00000113791 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095849] [ENSMUST00000121584] [ENSMUST00000142295]
Predicted Effect possibly damaging
Transcript: ENSMUST00000095849
AA Change: I693N

PolyPhen 2 Score 0.741 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000093533
Gene: ENSMUSG00000014039
AA Change: I693N

DomainStartEndE-ValueType
SET 75 191 5.96e-1 SMART
ZnF_C2H2 223 245 3.99e0 SMART
low complexity region 290 303 N/A INTRINSIC
ZnF_C2H2 402 424 3.89e-3 SMART
ZnF_C2H2 434 457 2.75e-3 SMART
ZnF_C2H2 468 488 1.88e2 SMART
ZnF_C2H2 495 517 5.42e-2 SMART
ZnF_C2H2 522 544 1.36e-2 SMART
ZnF_C2H2 571 593 6.23e-2 SMART
ZnF_C2H2 598 620 2.75e-3 SMART
low complexity region 642 657 N/A INTRINSIC
ZnF_C2H2 661 684 2.17e-1 SMART
ZnF_C2H2 689 711 3.24e0 SMART
ZnF_C2H2 725 747 1.38e-3 SMART
ZnF_C2H2 753 775 5.67e-5 SMART
ZnF_C2H2 781 803 3.11e-2 SMART
ZnF_C2H2 809 831 8.34e-3 SMART
ZnF_C2H2 837 859 4.79e-3 SMART
ZnF_C2H2 865 888 4.79e-3 SMART
ZnF_C2H2 894 917 5.06e-2 SMART
low complexity region 948 959 N/A INTRINSIC
low complexity region 1148 1170 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000121584
AA Change: I667N

PolyPhen 2 Score 0.741 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000113791
Gene: ENSMUSG00000014039
AA Change: I667N

DomainStartEndE-ValueType
SET 49 165 5.96e-1 SMART
ZnF_C2H2 197 219 3.99e0 SMART
low complexity region 264 277 N/A INTRINSIC
ZnF_C2H2 376 398 3.89e-3 SMART
ZnF_C2H2 408 431 2.75e-3 SMART
ZnF_C2H2 442 462 1.88e2 SMART
ZnF_C2H2 469 491 5.42e-2 SMART
ZnF_C2H2 496 518 1.36e-2 SMART
ZnF_C2H2 545 567 6.23e-2 SMART
ZnF_C2H2 572 594 2.75e-3 SMART
low complexity region 616 631 N/A INTRINSIC
ZnF_C2H2 635 658 2.17e-1 SMART
ZnF_C2H2 663 685 3.24e0 SMART
ZnF_C2H2 699 721 1.38e-3 SMART
ZnF_C2H2 727 749 5.67e-5 SMART
ZnF_C2H2 755 777 3.11e-2 SMART
ZnF_C2H2 783 805 8.34e-3 SMART
ZnF_C2H2 811 833 4.79e-3 SMART
ZnF_C2H2 839 862 4.79e-3 SMART
ZnF_C2H2 868 891 5.06e-2 SMART
low complexity region 922 933 N/A INTRINSIC
low complexity region 1122 1144 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136529
Predicted Effect probably benign
Transcript: ENSMUST00000142295
SMART Domains Protein: ENSMUSP00000120497
Gene: ENSMUSG00000014039

DomainStartEndE-ValueType
SET 49 165 5.96e-1 SMART
low complexity region 230 243 N/A INTRINSIC
ZnF_C2H2 342 364 3.89e-3 SMART
ZnF_C2H2 369 392 2.75e-3 SMART
ZnF_C2H2 403 423 1.88e2 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5031439G07Rik A T 15: 84,960,597 V30D probably damaging Het
Atl3 T A 19: 7,529,011 M302K probably benign Het
Ccdc91 C G 6: 147,575,503 L230V unknown Het
Ciz1 C T 2: 32,376,040 T39I probably damaging Het
Cog8 T C 8: 107,050,148 T532A probably benign Het
Ctsr C T 13: 61,161,853 G181S possibly damaging Het
Drc7 T C 8: 95,074,333 probably null Het
Dvl2 A G 11: 70,005,993 R238G possibly damaging Het
Faf1 T C 4: 109,935,666 F612L probably benign Het
Fbxo40 T A 16: 36,968,934 M605L probably benign Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Gprc6a A T 10: 51,614,980 M716K probably benign Het
Greb1l G A 18: 10,542,427 E1341K probably damaging Het
Jcad A T 18: 4,676,044 T1269S possibly damaging Het
Kif23 C G 9: 61,944,216 G66A probably benign Het
Lrrd1 T C 5: 3,850,619 M308T probably benign Het
Lsg1 C T 16: 30,561,775 A615T probably benign Het
Mcph1 G A 8: 18,671,207 V684M probably damaging Het
Mpv17l T C 16: 13,946,794 Y62H probably damaging Het
Olfr270 G T 4: 52,971,068 W149L probably damaging Het
Olfr713 T C 7: 107,036,358 S68P probably damaging Het
Osgepl1 A T 1: 53,321,200 M362L possibly damaging Het
P2ry14 T C 3: 59,115,031 probably null Het
Pacsin3 T A 2: 91,264,235 C402S probably damaging Het
Papss2 A G 19: 32,660,664 Y392C probably damaging Het
Plekha8 T A 6: 54,613,106 W19R probably damaging Het
Rab11fip2 A G 19: 59,935,610 S279P probably damaging Het
Slc6a20b C A 9: 123,611,989 G131C probably null Het
Suox T C 10: 128,671,293 I289V possibly damaging Het
Tbc1d16 C T 11: 119,158,730 probably null Het
Tmem269 T C 4: 119,209,949 T146A probably benign Het
Ttc30a1 A T 2: 75,981,371 Y123N probably damaging Het
Ttn G A 2: 76,728,567 R29657W probably damaging Het
Vmn1r84 C A 7: 12,362,226 C168F probably damaging Het
Zc3h7b T C 15: 81,773,298 F180L probably benign Het
Zfand4 C G 6: 116,287,995 D140E probably damaging Het
Other mutations in Prdm15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00973:Prdm15 APN 16 97806167 splice site probably benign
IGL01325:Prdm15 APN 16 97806517 missense probably damaging 1.00
IGL02195:Prdm15 APN 16 97835829 missense probably damaging 1.00
IGL02473:Prdm15 APN 16 97837605 unclassified probably null
IGL02502:Prdm15 APN 16 97839339 missense probably damaging 1.00
IGL02604:Prdm15 APN 16 97821942 missense probably benign
R0408:Prdm15 UTSW 16 97835786 missense possibly damaging 0.92
R0437:Prdm15 UTSW 16 97812559 missense probably benign 0.00
R0497:Prdm15 UTSW 16 97794334 missense possibly damaging 0.63
R0590:Prdm15 UTSW 16 97797761 missense possibly damaging 0.95
R0630:Prdm15 UTSW 16 97837707 missense probably null 1.00
R0661:Prdm15 UTSW 16 97829682 missense probably benign 0.34
R0718:Prdm15 UTSW 16 97812633 missense possibly damaging 0.89
R1144:Prdm15 UTSW 16 97808708 missense probably damaging 1.00
R1240:Prdm15 UTSW 16 97837600 missense probably damaging 0.98
R1605:Prdm15 UTSW 16 97839306 missense probably damaging 1.00
R1908:Prdm15 UTSW 16 97837685 missense probably benign 0.27
R2081:Prdm15 UTSW 16 97803780 nonsense probably null
R2208:Prdm15 UTSW 16 97799264 intron probably null
R3787:Prdm15 UTSW 16 97797745 missense probably benign 0.00
R3890:Prdm15 UTSW 16 97799571 missense probably damaging 1.00
R4326:Prdm15 UTSW 16 97806515 missense probably damaging 1.00
R4728:Prdm15 UTSW 16 97821786 missense probably benign 0.04
R4952:Prdm15 UTSW 16 97806077 missense probably damaging 0.99
R4998:Prdm15 UTSW 16 97794489 missense probably damaging 0.97
R5225:Prdm15 UTSW 16 97808675 missense probably damaging 1.00
R5505:Prdm15 UTSW 16 97816983 missense possibly damaging 0.76
R5628:Prdm15 UTSW 16 97799623 missense probably damaging 0.98
R5873:Prdm15 UTSW 16 97808689 missense probably damaging 1.00
R5980:Prdm15 UTSW 16 97812570 nonsense probably null
R6311:Prdm15 UTSW 16 97799055 missense probably null 0.08
R6540:Prdm15 UTSW 16 97835805 missense probably benign 0.13
R7053:Prdm15 UTSW 16 97794542 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ACGTGTACAGAAGGCTGGTG -3'
(R):5'- CATGAGTAGCTGACCCTCTTC -3'

Sequencing Primer
(F):5'- GCAGGTGTCCCAGATATCTG -3'
(R):5'- CTTCGGGTATCTAGCTGACACGAG -3'
Posted On2017-01-03