Incidental Mutation 'R5733:Ranbp2'
ID451546
Institutional Source Beutler Lab
Gene Symbol Ranbp2
Ensembl Gene ENSMUSG00000003226
Gene NameRAN binding protein 2
SynonymsA430087B05Rik
MMRRC Submission 043193-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5733 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location58446920-58494356 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 58485836 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Asparagine at position 2652 (D2652N)
Ref Sequence ENSEMBL: ENSMUSP00000003310 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003310]
Predicted Effect probably damaging
Transcript: ENSMUST00000003310
AA Change: D2652N

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000003310
Gene: ENSMUSG00000003226
AA Change: D2652N

DomainStartEndE-ValueType
Pfam:TPR_1 60 93 1.8e-7 PFAM
Pfam:TPR_8 60 93 8.9e-6 PFAM
low complexity region 235 247 N/A INTRINSIC
low complexity region 778 801 N/A INTRINSIC
coiled coil region 808 832 N/A INTRINSIC
RanBD 1166 1295 6.47e-64 SMART
ZnF_RBZ 1348 1372 5.49e-2 SMART
ZnF_RBZ 1412 1436 3.06e-6 SMART
ZnF_RBZ 1471 1495 4.16e-8 SMART
ZnF_RBZ 1500 1524 4.57e-5 SMART
ZnF_RBZ 1560 1584 3.52e-6 SMART
ZnF_RBZ 1619 1643 1.35e-7 SMART
RanBD 1850 1979 2.84e-60 SMART
low complexity region 2034 2048 N/A INTRINSIC
low complexity region 2069 2090 N/A INTRINSIC
low complexity region 2106 2121 N/A INTRINSIC
RanBD 2147 2276 4.96e-83 SMART
low complexity region 2310 2317 N/A INTRINSIC
low complexity region 2328 2342 N/A INTRINSIC
Pfam:IR1-M 2468 2530 2.5e-27 PFAM
Pfam:IR1-M 2544 2604 7e-30 PFAM
low complexity region 2673 2684 N/A INTRINSIC
low complexity region 2722 2732 N/A INTRINSIC
RanBD 2741 2869 5e-79 SMART
Pfam:Pro_isomerase 2896 3052 4.5e-45 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 97.0%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a gene trap allele display embryonic lethality. Heterozygous mice on some backgrounds display reduced ATP levels in the CNS, decreased glucose clearance, decreased weight gain on a high fat diet, and reduced scotopic responses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931406P16Rik A T 7: 34,245,080 S76T probably damaging Het
Acox3 T A 5: 35,605,199 probably null Het
Ahnak2 A T 12: 112,775,666 Y657* probably null Het
Anxa3 T A 5: 96,820,472 I128N probably damaging Het
Bsnd T C 4: 106,488,001 T83A probably benign Het
Capn10 A G 1: 92,943,913 Y411C probably benign Het
Capn3 G A 2: 120,484,594 W201* probably null Het
Crtap T C 9: 114,378,096 T365A probably benign Het
Daam1 A G 12: 71,945,498 D329G unknown Het
Dmxl2 A T 9: 54,376,266 L2761Q possibly damaging Het
Dpcr1 T C 17: 35,638,210 M166V probably benign Het
Fcho2 A C 13: 98,789,802 V91G probably damaging Het
Fen1 A T 19: 10,200,658 C141S possibly damaging Het
Fkbp15 G C 4: 62,306,929 A831G probably benign Het
Frmd4a A T 2: 4,300,957 R14S possibly damaging Het
Fzr1 A G 10: 81,370,326 F176L possibly damaging Het
Garem2 A G 5: 30,116,338 D565G probably damaging Het
Iqca G T 1: 90,070,535 T549K probably damaging Het
Itgax T A 7: 128,140,475 S686R probably damaging Het
Knop1 C A 7: 118,846,082 G220C probably damaging Het
Lyzl1 T A 18: 4,169,142 C49S probably damaging Het
Mpzl1 A T 1: 165,605,611 I157K probably benign Het
Mrgprb2 T C 7: 48,552,513 I155V probably benign Het
Mvb12b T C 2: 33,827,716 T167A probably benign Het
Myh3 A G 11: 67,088,619 N491S probably benign Het
Myo5b A G 18: 74,654,057 D511G possibly damaging Het
Olfr1053 T G 2: 86,315,214 Q24P probably damaging Het
Olfr1329 C T 4: 118,916,838 V210I probably benign Het
Olfr449 C T 6: 42,838,246 R122C probably damaging Het
Olfr749 T C 14: 50,737,052 T37A probably benign Het
Ptcd1 A G 5: 145,154,861 M476T probably damaging Het
Pum3 A G 19: 27,421,295 probably null Het
Rassf1 T C 9: 107,558,014 V166A probably damaging Het
Rictor A G 15: 6,783,104 H907R probably benign Het
Rorb T C 19: 18,988,107 E6G probably damaging Het
Serpina3f A T 12: 104,216,923 T15S possibly damaging Het
Sorbs2 T C 8: 45,759,189 L100P probably damaging Het
Sprr2k T C 3: 92,433,348 probably benign Het
Srrm2 T A 17: 23,821,386 S2431T probably damaging Het
Stox2 T A 8: 47,413,137 K57* probably null Het
Ttc21a G A 9: 119,941,261 V133I probably benign Het
Vasn T C 16: 4,650,162 Y658H possibly damaging Het
Zfp251 A G 15: 76,870,327 Y35H probably damaging Het
Other mutations in Ranbp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Ranbp2 APN 10 58477256 missense probably damaging 1.00
IGL00336:Ranbp2 APN 10 58451984 missense probably damaging 1.00
IGL00486:Ranbp2 APN 10 58477612 missense probably benign 0.06
IGL00800:Ranbp2 APN 10 58490704 missense probably benign
IGL00834:Ranbp2 APN 10 58453323 missense possibly damaging 0.94
IGL00852:Ranbp2 APN 10 58477901 missense probably benign
IGL00984:Ranbp2 APN 10 58461964 nonsense probably null
IGL01299:Ranbp2 APN 10 58492817 missense probably damaging 1.00
IGL01325:Ranbp2 APN 10 58476298 missense probably damaging 0.99
IGL01444:Ranbp2 APN 10 58475300 missense possibly damaging 0.79
IGL01545:Ranbp2 APN 10 58478881 missense possibly damaging 0.48
IGL01619:Ranbp2 APN 10 58464078 splice site probably null
IGL01782:Ranbp2 APN 10 58478309 missense probably damaging 0.97
IGL02020:Ranbp2 APN 10 58479947 missense probably damaging 1.00
IGL02096:Ranbp2 APN 10 58461967 missense probably damaging 1.00
IGL02182:Ranbp2 APN 10 58485760 nonsense probably null
IGL02211:Ranbp2 APN 10 58478242 missense probably benign
IGL02249:Ranbp2 APN 10 58480078 missense possibly damaging 0.89
IGL02268:Ranbp2 APN 10 58493653 unclassified probably benign
IGL02421:Ranbp2 APN 10 58480554 missense probably damaging 1.00
IGL03080:Ranbp2 APN 10 58476791 missense probably benign 0.01
IGL03119:Ranbp2 APN 10 58452003 missense probably damaging 1.00
IGL03206:Ranbp2 APN 10 58465547 missense probably damaging 1.00
IGL03237:Ranbp2 APN 10 58492961 missense probably damaging 0.98
En_passant UTSW 10 58452017 missense probably damaging 1.00
red_river UTSW 10 58465667 missense probably damaging 1.00
IGL02799:Ranbp2 UTSW 10 58480264 missense probably damaging 1.00
R0058:Ranbp2 UTSW 10 58480531 missense probably damaging 0.98
R0058:Ranbp2 UTSW 10 58480531 missense probably damaging 0.98
R0145:Ranbp2 UTSW 10 58480046 missense probably damaging 1.00
R0309:Ranbp2 UTSW 10 58479868 missense probably benign 0.04
R0375:Ranbp2 UTSW 10 58477283 missense probably damaging 1.00
R0441:Ranbp2 UTSW 10 58485768 missense probably benign 0.40
R0494:Ranbp2 UTSW 10 58467432 missense possibly damaging 0.53
R0542:Ranbp2 UTSW 10 58478414 missense probably benign 0.02
R0565:Ranbp2 UTSW 10 58476336 missense probably benign 0.41
R0608:Ranbp2 UTSW 10 58493898 missense probably damaging 1.00
R0661:Ranbp2 UTSW 10 58478733 missense probably benign
R0670:Ranbp2 UTSW 10 58480698 missense probably benign 0.01
R0760:Ranbp2 UTSW 10 58476791 missense possibly damaging 0.70
R0811:Ranbp2 UTSW 10 58465529 missense probably benign 0.01
R0812:Ranbp2 UTSW 10 58465529 missense probably benign 0.01
R1180:Ranbp2 UTSW 10 58465463 missense probably damaging 1.00
R1196:Ranbp2 UTSW 10 58477053 missense probably damaging 1.00
R1216:Ranbp2 UTSW 10 58483212 splice site probably benign
R1374:Ranbp2 UTSW 10 58485893 splice site probably benign
R1541:Ranbp2 UTSW 10 58483094 missense possibly damaging 0.90
R1589:Ranbp2 UTSW 10 58463986 missense probably benign 0.01
R1711:Ranbp2 UTSW 10 58460519 missense probably benign 0.11
R1761:Ranbp2 UTSW 10 58485741 missense probably benign 0.02
R1831:Ranbp2 UTSW 10 58479222 nonsense probably null
R1840:Ranbp2 UTSW 10 58478766 missense probably benign 0.41
R1869:Ranbp2 UTSW 10 58492561 missense probably damaging 1.00
R1871:Ranbp2 UTSW 10 58492561 missense probably damaging 1.00
R1892:Ranbp2 UTSW 10 58464099 missense probably benign 0.36
R2270:Ranbp2 UTSW 10 58455927 missense probably benign 0.06
R2363:Ranbp2 UTSW 10 58478936 missense possibly damaging 0.79
R3844:Ranbp2 UTSW 10 58477895 missense possibly damaging 0.87
R3937:Ranbp2 UTSW 10 58476472 missense probably benign 0.00
R3938:Ranbp2 UTSW 10 58476472 missense probably benign 0.00
R4025:Ranbp2 UTSW 10 58480556 missense probably benign 0.23
R4183:Ranbp2 UTSW 10 58465666 missense possibly damaging 0.53
R4247:Ranbp2 UTSW 10 58478864 missense possibly damaging 0.79
R4334:Ranbp2 UTSW 10 58463994 missense probably damaging 1.00
R4656:Ranbp2 UTSW 10 58453422 missense possibly damaging 0.82
R4746:Ranbp2 UTSW 10 58492670 missense probably damaging 1.00
R4852:Ranbp2 UTSW 10 58477056 missense possibly damaging 0.94
R4863:Ranbp2 UTSW 10 58492421 missense probably damaging 0.99
R5011:Ranbp2 UTSW 10 58461895 missense probably benign 0.36
R5014:Ranbp2 UTSW 10 58464120 missense probably benign 0.40
R5145:Ranbp2 UTSW 10 58480038 missense probably damaging 1.00
R5178:Ranbp2 UTSW 10 58476785 missense probably benign 0.01
R5199:Ranbp2 UTSW 10 58464443 missense probably benign
R5294:Ranbp2 UTSW 10 58478668 missense probably benign 0.23
R5508:Ranbp2 UTSW 10 58480005 missense probably damaging 0.97
R5511:Ranbp2 UTSW 10 58493739 missense probably benign 0.29
R5575:Ranbp2 UTSW 10 58492583 missense probably damaging 1.00
R5617:Ranbp2 UTSW 10 58465667 missense probably damaging 1.00
R5630:Ranbp2 UTSW 10 58479076 missense probably damaging 1.00
R5751:Ranbp2 UTSW 10 58464264 splice site probably null
R5767:Ranbp2 UTSW 10 58476825 missense probably benign 0.02
R6122:Ranbp2 UTSW 10 58465529 missense probably benign 0.02
R6147:Ranbp2 UTSW 10 58479428 missense probably damaging 1.00
R6286:Ranbp2 UTSW 10 58479572 missense probably benign 0.02
R6344:Ranbp2 UTSW 10 58483886 splice site probably null
R6452:Ranbp2 UTSW 10 58478157 missense probably benign 0.00
R6487:Ranbp2 UTSW 10 58485741 missense probably benign 0.02
R6620:Ranbp2 UTSW 10 58455807 critical splice acceptor site probably null
R6759:Ranbp2 UTSW 10 58457737 nonsense probably null
R7010:Ranbp2 UTSW 10 58454571 critical splice acceptor site probably null
R7071:Ranbp2 UTSW 10 58492837 missense probably damaging 1.00
R7083:Ranbp2 UTSW 10 58479230 missense probably damaging 1.00
R7088:Ranbp2 UTSW 10 58463906 missense probably damaging 1.00
R7102:Ranbp2 UTSW 10 58463950 missense probably damaging 1.00
R7194:Ranbp2 UTSW 10 58476769 missense probably benign 0.05
R7217:Ranbp2 UTSW 10 58452017 missense probably damaging 1.00
R7318:Ranbp2 UTSW 10 58483087 nonsense probably null
R7341:Ranbp2 UTSW 10 58485797 missense possibly damaging 0.72
R7398:Ranbp2 UTSW 10 58467277 missense probably damaging 1.00
X0018:Ranbp2 UTSW 10 58478584 missense probably benign 0.13
X0022:Ranbp2 UTSW 10 58465155 missense probably benign 0.33
Z1088:Ranbp2 UTSW 10 58477972 frame shift probably null
Z1088:Ranbp2 UTSW 10 58477983 frame shift probably null
Z1088:Ranbp2 UTSW 10 58492893 missense probably benign 0.35
Predicted Primers PCR Primer
(F):5'- AATCAGAGAGGTAGGTTGGTTC -3'
(R):5'- ACTGTGACAAATACATTATGCTCC -3'

Sequencing Primer
(F):5'- GTGGCTCACAACCATCTGTAATGG -3'
(R):5'- ACACATAGGCAGAACCTT -3'
Posted On2017-01-03