Incidental Mutation 'R1761:Ranbp2'
ID192785
Institutional Source Beutler Lab
Gene Symbol Ranbp2
Ensembl Gene ENSMUSG00000003226
Gene NameRAN binding protein 2
SynonymsA430087B05Rik
MMRRC Submission 039793-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1761 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location58446920-58494356 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 58485741 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 2620 (V2620A)
Ref Sequence ENSEMBL: ENSMUSP00000003310 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003310]
Predicted Effect probably benign
Transcript: ENSMUST00000003310
AA Change: V2620A

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000003310
Gene: ENSMUSG00000003226
AA Change: V2620A

DomainStartEndE-ValueType
Pfam:TPR_1 60 93 1.8e-7 PFAM
Pfam:TPR_8 60 93 8.9e-6 PFAM
low complexity region 235 247 N/A INTRINSIC
low complexity region 778 801 N/A INTRINSIC
coiled coil region 808 832 N/A INTRINSIC
RanBD 1166 1295 6.47e-64 SMART
ZnF_RBZ 1348 1372 5.49e-2 SMART
ZnF_RBZ 1412 1436 3.06e-6 SMART
ZnF_RBZ 1471 1495 4.16e-8 SMART
ZnF_RBZ 1500 1524 4.57e-5 SMART
ZnF_RBZ 1560 1584 3.52e-6 SMART
ZnF_RBZ 1619 1643 1.35e-7 SMART
RanBD 1850 1979 2.84e-60 SMART
low complexity region 2034 2048 N/A INTRINSIC
low complexity region 2069 2090 N/A INTRINSIC
low complexity region 2106 2121 N/A INTRINSIC
RanBD 2147 2276 4.96e-83 SMART
low complexity region 2310 2317 N/A INTRINSIC
low complexity region 2328 2342 N/A INTRINSIC
Pfam:IR1-M 2468 2530 2.5e-27 PFAM
Pfam:IR1-M 2544 2604 7e-30 PFAM
low complexity region 2673 2684 N/A INTRINSIC
low complexity region 2722 2732 N/A INTRINSIC
RanBD 2741 2869 5e-79 SMART
Pfam:Pro_isomerase 2896 3052 4.5e-45 PFAM
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.4%
  • 20x: 92.9%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a gene trap allele display embryonic lethality. Heterozygous mice on some backgrounds display reduced ATP levels in the CNS, decreased glucose clearance, decreased weight gain on a high fat diet, and reduced scotopic responses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110017D15Rik G A 4: 41,507,223 P109L probably damaging Het
Abi3bp C T 16: 56,668,309 H1268Y possibly damaging Het
Acan T A 7: 79,094,085 Y621* probably null Het
Aig1 T C 10: 13,690,584 Y152C probably damaging Het
Arhgap33 C T 7: 30,533,063 probably null Het
Bcl6 G T 16: 23,977,542 A45D probably damaging Het
Cbx5 T C 15: 103,213,180 D10G possibly damaging Het
Ccdc191 A G 16: 43,943,510 I445V probably benign Het
Cdk4 T A 10: 127,064,677 probably null Het
Chil6 A G 3: 106,394,338 F149L probably damaging Het
Cntn5 T C 9: 10,172,054 T42A probably benign Het
Cpn2 A T 16: 30,260,196 I229N probably damaging Het
Cpne8 A G 15: 90,648,618 V62A probably damaging Het
Cr2 A G 1: 195,155,123 probably null Het
Crnn A T 3: 93,148,651 H248L probably benign Het
Csn1s1 A G 5: 87,679,035 S254G probably benign Het
Cubn A G 2: 13,489,317 probably null Het
Dnah8 A G 17: 30,779,916 N3525S probably damaging Het
Dpp3 A G 19: 4,921,149 L220P probably benign Het
Fam110a T C 2: 151,970,205 E215G probably benign Het
Fam20a A T 11: 109,677,838 N287K probably damaging Het
Fat4 T C 3: 38,887,489 V177A possibly damaging Het
Fzd8 C T 18: 9,213,643 R242C probably damaging Het
Gimap5 A T 6: 48,753,261 Q255L probably damaging Het
Gm13083 T C 4: 143,615,868 Y182H probably benign Het
Gm4787 A G 12: 81,377,176 L736S probably benign Het
Gmeb1 G A 4: 132,234,887 Q154* probably null Het
Gpr156 T C 16: 37,987,567 L192P probably damaging Het
Gpr179 A C 11: 97,335,106 S2074R probably benign Het
Hddc2 G T 10: 31,326,139 D161Y probably damaging Het
Hlcs T C 16: 94,268,007 D265G probably benign Het
Hspg2 A T 4: 137,514,673 I573F possibly damaging Het
Il1b T C 2: 129,365,181 K220E probably damaging Het
Il5 T C 11: 53,723,730 I66T probably damaging Het
Irf6 G A 1: 193,169,301 R400H probably damaging Het
Klra1 A T 6: 130,372,873 Y201N probably damaging Het
Lmf2 A G 15: 89,352,713 V442A possibly damaging Het
Mcm2 T C 6: 88,889,788 I412M possibly damaging Het
Mlkl T A 8: 111,333,723 L18F possibly damaging Het
Mug2 C A 6: 122,074,705 H949N probably benign Het
Nf1 T C 11: 79,384,265 F51L probably damaging Het
Olfr1049 T G 2: 86,255,039 Y218S probably damaging Het
Olfr592 T G 7: 103,187,118 C172W probably damaging Het
Olfr77 A T 9: 19,921,149 *313C probably null Het
P3h2 T C 16: 25,985,050 E322G probably damaging Het
Psmg2 CTTCAGTT CTTCAGTTCAGTT 18: 67,646,025 probably null Het
Ptdss1 T C 13: 66,956,412 V116A possibly damaging Het
Robo2 A G 16: 74,035,024 V256A probably damaging Het
Scg3 T A 9: 75,676,758 I154F probably damaging Het
Scgn A T 13: 23,959,706 F225Y probably damaging Het
Sec61b T C 4: 47,480,137 C58R possibly damaging Het
Slc25a46 G T 18: 31,607,262 Q96K possibly damaging Het
Sptb A G 12: 76,612,608 F1173L probably damaging Het
Srcap T A 7: 127,534,845 C893S probably damaging Het
Tet3 T C 6: 83,403,659 E509G probably damaging Het
Timm10b C T 7: 105,683,708 R897* probably null Het
Tln2 C T 9: 67,286,514 A1773T probably benign Het
Tom1 T C 8: 75,051,551 V87A probably benign Het
Tti1 T C 2: 158,007,697 I541V probably benign Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Tubb1 A G 2: 174,456,896 S124G probably benign Het
Vgll3 A T 16: 65,839,728 D310V probably damaging Het
Vmac A G 17: 56,715,788 L74P probably damaging Het
Zbtb1 A T 12: 76,385,821 K194* probably null Het
Zfp429 A G 13: 67,396,076 M76T probably benign Het
Zfp808 T A 13: 62,171,646 C230S possibly damaging Het
Zfp980 A G 4: 145,702,042 Y447C probably damaging Het
Zfp985 A G 4: 147,584,045 T457A probably benign Het
Other mutations in Ranbp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Ranbp2 APN 10 58477256 missense probably damaging 1.00
IGL00336:Ranbp2 APN 10 58451984 missense probably damaging 1.00
IGL00486:Ranbp2 APN 10 58477612 missense probably benign 0.06
IGL00800:Ranbp2 APN 10 58490704 missense probably benign
IGL00834:Ranbp2 APN 10 58453323 missense possibly damaging 0.94
IGL00852:Ranbp2 APN 10 58477901 missense probably benign
IGL00984:Ranbp2 APN 10 58461964 nonsense probably null
IGL01299:Ranbp2 APN 10 58492817 missense probably damaging 1.00
IGL01325:Ranbp2 APN 10 58476298 missense probably damaging 0.99
IGL01444:Ranbp2 APN 10 58475300 missense possibly damaging 0.79
IGL01545:Ranbp2 APN 10 58478881 missense possibly damaging 0.48
IGL01619:Ranbp2 APN 10 58464078 splice site probably null
IGL01782:Ranbp2 APN 10 58478309 missense probably damaging 0.97
IGL02020:Ranbp2 APN 10 58479947 missense probably damaging 1.00
IGL02096:Ranbp2 APN 10 58461967 missense probably damaging 1.00
IGL02182:Ranbp2 APN 10 58485760 nonsense probably null
IGL02211:Ranbp2 APN 10 58478242 missense probably benign
IGL02249:Ranbp2 APN 10 58480078 missense possibly damaging 0.89
IGL02268:Ranbp2 APN 10 58493653 unclassified probably benign
IGL02421:Ranbp2 APN 10 58480554 missense probably damaging 1.00
IGL03080:Ranbp2 APN 10 58476791 missense probably benign 0.01
IGL03119:Ranbp2 APN 10 58452003 missense probably damaging 1.00
IGL03206:Ranbp2 APN 10 58465547 missense probably damaging 1.00
IGL03237:Ranbp2 APN 10 58492961 missense probably damaging 0.98
red_river UTSW 10 58465667 missense probably damaging 1.00
IGL02799:Ranbp2 UTSW 10 58480264 missense probably damaging 1.00
R0058:Ranbp2 UTSW 10 58480531 missense probably damaging 0.98
R0058:Ranbp2 UTSW 10 58480531 missense probably damaging 0.98
R0145:Ranbp2 UTSW 10 58480046 missense probably damaging 1.00
R0309:Ranbp2 UTSW 10 58479868 missense probably benign 0.04
R0375:Ranbp2 UTSW 10 58477283 missense probably damaging 1.00
R0441:Ranbp2 UTSW 10 58485768 missense probably benign 0.40
R0494:Ranbp2 UTSW 10 58467432 missense possibly damaging 0.53
R0542:Ranbp2 UTSW 10 58478414 missense probably benign 0.02
R0565:Ranbp2 UTSW 10 58476336 missense probably benign 0.41
R0608:Ranbp2 UTSW 10 58493898 missense probably damaging 1.00
R0661:Ranbp2 UTSW 10 58478733 missense probably benign
R0670:Ranbp2 UTSW 10 58480698 missense probably benign 0.01
R0760:Ranbp2 UTSW 10 58476791 missense possibly damaging 0.70
R0811:Ranbp2 UTSW 10 58465529 missense probably benign 0.01
R0812:Ranbp2 UTSW 10 58465529 missense probably benign 0.01
R1180:Ranbp2 UTSW 10 58465463 missense probably damaging 1.00
R1196:Ranbp2 UTSW 10 58477053 missense probably damaging 1.00
R1216:Ranbp2 UTSW 10 58483212 splice site probably benign
R1374:Ranbp2 UTSW 10 58485893 splice site probably benign
R1541:Ranbp2 UTSW 10 58483094 missense possibly damaging 0.90
R1589:Ranbp2 UTSW 10 58463986 missense probably benign 0.01
R1711:Ranbp2 UTSW 10 58460519 missense probably benign 0.11
R1831:Ranbp2 UTSW 10 58479222 nonsense probably null
R1840:Ranbp2 UTSW 10 58478766 missense probably benign 0.41
R1869:Ranbp2 UTSW 10 58492561 missense probably damaging 1.00
R1871:Ranbp2 UTSW 10 58492561 missense probably damaging 1.00
R1892:Ranbp2 UTSW 10 58464099 missense probably benign 0.36
R2270:Ranbp2 UTSW 10 58455927 missense probably benign 0.06
R2363:Ranbp2 UTSW 10 58478936 missense possibly damaging 0.79
R3844:Ranbp2 UTSW 10 58477895 missense possibly damaging 0.87
R3937:Ranbp2 UTSW 10 58476472 missense probably benign 0.00
R3938:Ranbp2 UTSW 10 58476472 missense probably benign 0.00
R4025:Ranbp2 UTSW 10 58480556 missense probably benign 0.23
R4183:Ranbp2 UTSW 10 58465666 missense possibly damaging 0.53
R4247:Ranbp2 UTSW 10 58478864 missense possibly damaging 0.79
R4334:Ranbp2 UTSW 10 58463994 missense probably damaging 1.00
R4656:Ranbp2 UTSW 10 58453422 missense possibly damaging 0.82
R4746:Ranbp2 UTSW 10 58492670 missense probably damaging 1.00
R4852:Ranbp2 UTSW 10 58477056 missense possibly damaging 0.94
R4863:Ranbp2 UTSW 10 58492421 missense probably damaging 0.99
R5011:Ranbp2 UTSW 10 58461895 missense probably benign 0.36
R5014:Ranbp2 UTSW 10 58464120 missense probably benign 0.40
R5145:Ranbp2 UTSW 10 58480038 missense probably damaging 1.00
R5178:Ranbp2 UTSW 10 58476785 missense probably benign 0.01
R5199:Ranbp2 UTSW 10 58464443 missense probably benign
R5294:Ranbp2 UTSW 10 58478668 missense probably benign 0.23
R5508:Ranbp2 UTSW 10 58480005 missense probably damaging 0.97
R5511:Ranbp2 UTSW 10 58493739 missense probably benign 0.29
R5575:Ranbp2 UTSW 10 58492583 missense probably damaging 1.00
R5617:Ranbp2 UTSW 10 58465667 missense probably damaging 1.00
R5630:Ranbp2 UTSW 10 58479076 missense probably damaging 1.00
R5733:Ranbp2 UTSW 10 58485836 missense probably damaging 1.00
R5751:Ranbp2 UTSW 10 58464264 splice site probably null
R5767:Ranbp2 UTSW 10 58476825 missense probably benign 0.02
R6122:Ranbp2 UTSW 10 58465529 missense probably benign 0.02
R6147:Ranbp2 UTSW 10 58479428 missense probably damaging 1.00
R6286:Ranbp2 UTSW 10 58479572 missense probably benign 0.02
R6344:Ranbp2 UTSW 10 58483886 splice site probably null
R6452:Ranbp2 UTSW 10 58478157 missense probably benign 0.00
R6487:Ranbp2 UTSW 10 58485741 missense probably benign 0.02
R6620:Ranbp2 UTSW 10 58455807 critical splice acceptor site probably null
R6759:Ranbp2 UTSW 10 58457737 nonsense probably null
X0018:Ranbp2 UTSW 10 58478584 missense probably benign 0.13
X0022:Ranbp2 UTSW 10 58465155 missense probably benign 0.33
Z1088:Ranbp2 UTSW 10 58477972 frame shift probably null
Z1088:Ranbp2 UTSW 10 58477983 frame shift probably null
Z1088:Ranbp2 UTSW 10 58492893 missense probably benign 0.35
Predicted Primers PCR Primer
(F):5'- AACTTCTCATTCTCCTAAACCTGTTAATGTCC -3'
(R):5'- ACTCTATTTTCTCAAACACATAGGCAGAACC -3'

Sequencing Primer
(F):5'- agttcagttcccagcaacc -3'
(R):5'- GCTTGGGAATTCCATGTCAGT -3'
Posted On2014-05-23