Incidental Mutation 'R5850:Wdr45b'
ID454635
Institutional Source Beutler Lab
Gene Symbol Wdr45b
Ensembl Gene ENSMUSG00000025173
Gene NameWD repeat domain 45B
SynonymsD16Bwg0193e, 0610008N23Rik, Wdr45l
MMRRC Submission 043226-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.183) question?
Stock #R5850 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location121327224-121354445 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to G at 121331097 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000119591 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026173] [ENSMUST00000106110] [ENSMUST00000136797]
Predicted Effect probably benign
Transcript: ENSMUST00000026173
SMART Domains Protein: ENSMUSP00000026173
Gene: ENSMUSG00000025173

DomainStartEndE-ValueType
Blast:WD40 11 37 2e-9 BLAST
low complexity region 70 79 N/A INTRINSIC
Blast:WD40 89 124 6e-11 BLAST
Blast:WD40 128 170 1e-5 BLAST
WD40 174 214 1.38e-2 SMART
WD40 217 258 3.71e-1 SMART
low complexity region 278 289 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000106110
AA Change: V217A
SMART Domains Protein: ENSMUSP00000101716
Gene: ENSMUSG00000025173
AA Change: V217A

DomainStartEndE-ValueType
PDB:4EXV|A 3 205 9e-16 PDB
Blast:WD40 9 37 7e-11 BLAST
SCOP:d1tbga_ 9 205 6e-10 SMART
Blast:WD40 89 124 2e-11 BLAST
Blast:WD40 128 170 2e-6 BLAST
Blast:WD40 174 210 2e-16 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000136797
SMART Domains Protein: ENSMUSP00000119591
Gene: ENSMUSG00000025173

DomainStartEndE-ValueType
PDB:4EXV|A 3 171 1e-9 PDB
Blast:WD40 9 37 2e-11 BLAST
SCOP:d1tbga_ 18 171 6e-8 SMART
Blast:WD40 55 90 6e-12 BLAST
Blast:WD40 94 136 1e-6 BLAST
Blast:WD40 140 172 2e-15 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137230
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the WIPI or SVP1 family of WD40 repeat-containing proteins. The protein contains seven WD40 repeats that are thought to fold into a beta-propeller structure that mediates protein-protein interactions, and a conserved motif for interaction with phospholipids. The human genome contains several pseudogenes of this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930553M12Rik T C 4: 88,868,359 I7M unknown Het
Abca8b C A 11: 109,977,813 G175V probably damaging Het
Abhd14a A C 9: 106,440,349 L225R probably damaging Het
Apbb1 A G 7: 105,567,583 S39P probably damaging Het
Apc T C 18: 34,318,063 S2637P possibly damaging Het
Apold1 T C 6: 134,984,095 F171L probably damaging Het
Ascc3 T C 10: 50,710,953 M967T probably damaging Het
Atf7ip T C 6: 136,566,787 probably null Het
Bcl2l15 T A 3: 103,836,116 V111D possibly damaging Het
Bsn A T 9: 108,114,950 M1201K probably damaging Het
Ccdc141 T A 2: 77,029,403 N965Y probably damaging Het
Cnn3 T C 3: 121,451,928 Y98H probably damaging Het
Cnot1 G A 8: 95,734,147 R117* probably null Het
Dlgap1 G A 17: 70,787,092 V803M probably damaging Het
Drd3 A C 16: 43,818,332 M299L probably benign Het
Ergic2 C A 6: 148,183,107 M34I possibly damaging Het
Ext2 A T 2: 93,813,659 D92E possibly damaging Het
Fmnl1 A G 11: 103,195,285 probably benign Het
Ganab C T 19: 8,911,707 R591W probably damaging Het
Kdsr A T 1: 106,755,442 probably null Het
Macf1 T C 4: 123,507,306 E813G probably damaging Het
Nlrc5 A G 8: 94,521,047 T1621A probably benign Het
Nmnat1 G A 4: 149,469,667 Q139* probably null Het
Os9 TTCCTCCTCCTCCTCCTCCTC TTCCTCCTCCTCCTCCTC 10: 127,098,479 probably benign Het
Oxa1l T G 14: 54,367,664 V11G possibly damaging Het
Padi1 A G 4: 140,814,830 Y594H probably benign Het
Polr1a T A 6: 71,926,683 F327I probably benign Het
Prf1 G T 10: 61,300,193 A83S probably benign Het
Ptgs2 A G 1: 150,105,376 E470G probably benign Het
Rictor G A 15: 6,794,006 E1555K probably benign Het
Skint8 C A 4: 111,950,193 L359M probably damaging Het
Slc19a2 A G 1: 164,263,456 I278V probably benign Het
Smco1 A T 16: 32,273,856 N115I probably damaging Het
Smyd3 G A 1: 179,043,855 L320F probably damaging Het
Svil T A 18: 5,098,900 probably null Het
Syne2 A G 12: 76,097,975 D1566G probably damaging Het
Tpm2 T C 4: 43,523,296 D20G probably damaging Het
Ubap1l A G 9: 65,373,763 Y241C probably damaging Het
Usp15 A G 10: 123,124,512 probably null Het
Zc3h14 A G 12: 98,779,155 I468V probably damaging Het
Zfp703 C T 8: 26,979,205 P299L probably damaging Het
Other mutations in Wdr45b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02532:Wdr45b APN 11 121328813 missense probably benign 0.00
R0930:Wdr45b UTSW 11 121330214 missense probably damaging 1.00
R1354:Wdr45b UTSW 11 121335430 missense probably damaging 0.98
R1600:Wdr45b UTSW 11 121330189 missense probably damaging 0.99
R4969:Wdr45b UTSW 11 121328824 nonsense probably null
R5133:Wdr45b UTSW 11 121328795 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- ATAAGCTCATCTCCAGCCCTG -3'
(R):5'- AGTAACTACAAGGGTGGTGTTG -3'

Sequencing Primer
(F):5'- TGCTCCTGGAGATGCAGCAG -3'
(R):5'- GAGCTCACTATATAAACTAGGCTGGC -3'
Posted On2017-02-10