Incidental Mutation 'R5850:Ergic2'
ID454618
Institutional Source Beutler Lab
Gene Symbol Ergic2
Ensembl Gene ENSMUSG00000030304
Gene NameERGIC and golgi 2
Synonyms
MMRRC Submission 043226-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.586) question?
Stock #R5850 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location148179079-148212374 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 148183107 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Isoleucine at position 34 (M34I)
Ref Sequence ENSEMBL: ENSMUSP00000144886 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032446] [ENSMUST00000111607] [ENSMUST00000136008] [ENSMUST00000143282] [ENSMUST00000204832]
Predicted Effect probably benign
Transcript: ENSMUST00000032446
Predicted Effect probably benign
Transcript: ENSMUST00000111607
SMART Domains Protein: ENSMUSP00000107234
Gene: ENSMUSG00000030303

DomainStartEndE-ValueType
Pfam:Polysacc_synt_2 13 159 2.9e-8 PFAM
Pfam:Epimerase 13 241 3.2e-10 PFAM
Pfam:3Beta_HSD 14 167 4.2e-7 PFAM
Pfam:NAD_binding_4 15 285 3.2e-73 PFAM
Pfam:Sterile 355 448 1.2e-29 PFAM
transmembrane domain 466 483 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126773
Predicted Effect possibly damaging
Transcript: ENSMUST00000136008
AA Change: M309I

PolyPhen 2 Score 0.865 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000120456
Gene: ENSMUSG00000030304
AA Change: M309I

DomainStartEndE-ValueType
Pfam:ERGIC_N 13 101 1.6e-26 PFAM
Pfam:COPIIcoated_ERV 157 333 4.8e-51 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140311
Predicted Effect probably benign
Transcript: ENSMUST00000143282
AA Change: M65I

PolyPhen 2 Score 0.334 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000145143
Gene: ENSMUSG00000030304
AA Change: M65I

DomainStartEndE-ValueType
Pfam:COPIIcoated_ERV 1 89 2.7e-14 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149631
Predicted Effect unknown
Transcript: ENSMUST00000203268
AA Change: M129I
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203993
Predicted Effect possibly damaging
Transcript: ENSMUST00000204832
AA Change: M34I

PolyPhen 2 Score 0.932 (Sensitivity: 0.80; Specificity: 0.94)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] ERGIC2, or PTX1, is a ubiquitously expressed nuclear protein that is downregulated in prostate carcinoma (Kwok et al., 2001 [PubMed 11445006]).[supplied by OMIM, Aug 2008]
PHENOTYPE: Mice homozygous for an ENU-induced point mutation affecting the donor splice site of intron 5 exhibit swelling of the hind feet and tail. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930553M12Rik T C 4: 88,868,359 I7M unknown Het
Abca8b C A 11: 109,977,813 G175V probably damaging Het
Abhd14a A C 9: 106,440,349 L225R probably damaging Het
Apbb1 A G 7: 105,567,583 S39P probably damaging Het
Apc T C 18: 34,318,063 S2637P possibly damaging Het
Apold1 T C 6: 134,984,095 F171L probably damaging Het
Ascc3 T C 10: 50,710,953 M967T probably damaging Het
Atf7ip T C 6: 136,566,787 probably null Het
Bcl2l15 T A 3: 103,836,116 V111D possibly damaging Het
Bsn A T 9: 108,114,950 M1201K probably damaging Het
Ccdc141 T A 2: 77,029,403 N965Y probably damaging Het
Cnn3 T C 3: 121,451,928 Y98H probably damaging Het
Cnot1 G A 8: 95,734,147 R117* probably null Het
Dlgap1 G A 17: 70,787,092 V803M probably damaging Het
Drd3 A C 16: 43,818,332 M299L probably benign Het
Ext2 A T 2: 93,813,659 D92E possibly damaging Het
Fmnl1 A G 11: 103,195,285 probably benign Het
Ganab C T 19: 8,911,707 R591W probably damaging Het
Kdsr A T 1: 106,755,442 probably null Het
Macf1 T C 4: 123,507,306 E813G probably damaging Het
Nlrc5 A G 8: 94,521,047 T1621A probably benign Het
Nmnat1 G A 4: 149,469,667 Q139* probably null Het
Os9 TTCCTCCTCCTCCTCCTCCTC TTCCTCCTCCTCCTCCTC 10: 127,098,479 probably benign Het
Oxa1l T G 14: 54,367,664 V11G possibly damaging Het
Padi1 A G 4: 140,814,830 Y594H probably benign Het
Polr1a T A 6: 71,926,683 F327I probably benign Het
Prf1 G T 10: 61,300,193 A83S probably benign Het
Ptgs2 A G 1: 150,105,376 E470G probably benign Het
Rictor G A 15: 6,794,006 E1555K probably benign Het
Skint8 C A 4: 111,950,193 L359M probably damaging Het
Slc19a2 A G 1: 164,263,456 I278V probably benign Het
Smco1 A T 16: 32,273,856 N115I probably damaging Het
Smyd3 G A 1: 179,043,855 L320F probably damaging Het
Svil T A 18: 5,098,900 probably null Het
Syne2 A G 12: 76,097,975 D1566G probably damaging Het
Tpm2 T C 4: 43,523,296 D20G probably damaging Het
Ubap1l A G 9: 65,373,763 Y241C probably damaging Het
Usp15 A G 10: 123,124,512 probably null Het
Wdr45b A G 11: 121,331,097 probably benign Het
Zc3h14 A G 12: 98,779,155 I468V probably damaging Het
Zfp703 C T 8: 26,979,205 P299L probably damaging Het
Other mutations in Ergic2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01083:Ergic2 APN 6 148195271 missense probably benign
IGL02191:Ergic2 APN 6 148204821 missense probably null 0.12
IGL02719:Ergic2 APN 6 148204819 missense possibly damaging 0.82
IGL02958:Ergic2 APN 6 148181943 makesense probably null
R0389:Ergic2 UTSW 6 148183202 missense probably benign 0.40
R0416:Ergic2 UTSW 6 148183144 missense probably damaging 1.00
R0727:Ergic2 UTSW 6 148199400 unclassified probably benign
R1835:Ergic2 UTSW 6 148189581 missense possibly damaging 0.61
R1891:Ergic2 UTSW 6 148183079 missense probably damaging 0.99
R1959:Ergic2 UTSW 6 148199354 critical splice donor site probably null
R2504:Ergic2 UTSW 6 148204774 critical splice donor site probably null
R3414:Ergic2 UTSW 6 148206681 splice site probably benign
R3732:Ergic2 UTSW 6 148202522 missense probably damaging 1.00
R3732:Ergic2 UTSW 6 148202522 missense probably damaging 1.00
R3733:Ergic2 UTSW 6 148202522 missense probably damaging 1.00
R3734:Ergic2 UTSW 6 148202522 missense probably damaging 1.00
R5002:Ergic2 UTSW 6 148184158 missense probably benign 0.00
R5083:Ergic2 UTSW 6 148196014 missense probably benign 0.00
R5088:Ergic2 UTSW 6 148183123 missense probably damaging 1.00
R6541:Ergic2 UTSW 6 148183150 missense probably damaging 1.00
R6652:Ergic2 UTSW 6 148189581 missense probably damaging 1.00
R7073:Ergic2 UTSW 6 148195209 missense probably damaging 1.00
R7167:Ergic2 UTSW 6 148206635 missense probably damaging 1.00
R7275:Ergic2 UTSW 6 148195259 missense probably damaging 1.00
R7299:Ergic2 UTSW 6 148188112 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAATCAGATATCAGAACATGGCAGC -3'
(R):5'- TGTATGGTCCAGGGCAGTTC -3'

Sequencing Primer
(F):5'- TATCAGAACATGGCAGCTACTG -3'
(R):5'- GTCCAGGGCAGTTCATCCTATG -3'
Posted On2017-02-10