Incidental Mutation 'R5889:Fndc8'
ID456235
Institutional Source Beutler Lab
Gene Symbol Fndc8
Ensembl Gene ENSMUSG00000018844
Gene Namefibronectin type III domain containing 8
Synonyms
MMRRC Submission 044090-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.053) question?
Stock #R5889 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location82892124-82900801 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 82898729 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 238 (T238S)
Ref Sequence ENSEMBL: ENSMUSP00000018988 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018988] [ENSMUST00000103213]
Predicted Effect probably damaging
Transcript: ENSMUST00000018988
AA Change: T238S

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000018988
Gene: ENSMUSG00000018844
AA Change: T238S

DomainStartEndE-ValueType
low complexity region 159 170 N/A INTRINSIC
FN3 176 264 9.48e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000103213
SMART Domains Protein: ENSMUSP00000099502
Gene: ENSMUSG00000020692

DomainStartEndE-ValueType
low complexity region 2 11 N/A INTRINSIC
Pfam:NLE 17 77 3.6e-15 PFAM
WD40 103 142 5.22e-12 SMART
WD40 145 184 1.48e-11 SMART
WD40 188 232 1.66e-5 SMART
WD40 235 273 3.11e-10 SMART
WD40 276 357 1.14e-3 SMART
WD40 361 400 8.81e-10 SMART
WD40 403 442 1.69e-11 SMART
WD40 445 484 9.44e-10 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124109
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140318
Predicted Effect probably benign
Transcript: ENSMUST00000167196
Meta Mutation Damage Score 0.274 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.3%
Validation Efficiency 100% (63/63)
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930568D16Rik T C 2: 35,354,449 E297G probably damaging Het
Astn1 C T 1: 158,600,380 P707L possibly damaging Het
Cep290 T C 10: 100,499,074 S319P possibly damaging Het
Chrna4 A C 2: 181,028,658 L435W probably damaging Het
Cilp C A 9: 65,280,343 A1240D possibly damaging Het
Col17a1 A G 19: 47,649,072 F1249S possibly damaging Het
Creb3l3 T C 10: 81,092,533 probably benign Het
Cyp4f40 C A 17: 32,675,757 T432N probably benign Het
Dsg1c T G 18: 20,283,601 I853R possibly damaging Het
Ebna1bp2 T A 4: 118,621,423 D34E probably damaging Het
Edc4 C T 8: 105,888,022 T112I possibly damaging Het
Enpep T A 3: 129,312,578 Y333F probably damaging Het
Exoc6 A G 19: 37,582,245 H291R probably damaging Het
Fbln5 G T 12: 101,765,226 N236K probably damaging Het
Frem3 T C 8: 80,614,288 V1070A probably damaging Het
Gabra4 A T 5: 71,571,891 N515K possibly damaging Het
Gemin5 A G 11: 58,122,355 V1422A possibly damaging Het
Gm10118 A G 10: 63,927,111 probably benign Het
Grm5 A G 7: 87,603,073 D177G probably damaging Het
Gtf2h4 G A 17: 35,670,900 P147L possibly damaging Het
Hgsnat T C 8: 25,963,367 D265G probably damaging Het
Hsd17b4 T A 18: 50,177,209 L513Q probably damaging Het
Hsd17b7 A T 1: 169,955,918 M307K probably benign Het
Hspa5 T C 2: 34,774,617 V361A probably damaging Het
Iqgap2 A G 13: 95,632,042 V1450A probably benign Het
Itpr3 A G 17: 27,115,065 E2037G probably damaging Het
Lama5 T C 2: 180,193,674 probably benign Het
Manba G T 3: 135,524,598 G311* probably null Het
Mettl24 T A 10: 40,746,490 V236E probably benign Het
Myh3 A G 11: 67,086,375 D310G probably damaging Het
Ncoa4 A T 14: 32,166,659 probably benign Het
Nop56 G T 2: 130,275,982 R126L probably damaging Het
Nos3 C A 5: 24,368,777 probably benign Het
Olfr156 T C 4: 43,820,492 M290V possibly damaging Het
Pcdhga3 T A 18: 37,676,609 V705D probably damaging Het
Prom2 C T 2: 127,529,411 A776T possibly damaging Het
Prss48 A G 3: 85,998,185 I127T probably damaging Het
Rtca T C 3: 116,499,583 Y193C possibly damaging Het
Samd9l T C 6: 3,376,460 Y267C probably damaging Het
Scube3 A G 17: 28,160,913 R272G possibly damaging Het
Sprr1a G T 3: 92,484,644 H17N probably benign Het
Ssfa2 T A 2: 79,657,728 D718E probably damaging Het
Stard3 G C 11: 98,375,535 Q120H probably benign Het
Supt6 A G 11: 78,212,748 I1377T probably damaging Het
Svop A T 5: 114,065,631 S30T probably benign Het
Syne2 T A 12: 76,072,252 L5882* probably null Het
Tanc2 G T 11: 105,921,807 R1359L probably benign Het
Tmc7 A C 7: 118,566,326 L55R probably benign Het
Trappc11 G A 8: 47,519,578 A320V probably benign Het
Ttll8 G C 15: 88,933,939 P178A probably damaging Het
Ttn T C 2: 76,730,649 E20809G probably damaging Het
Tubb2a A T 13: 34,075,468 V113E possibly damaging Het
Ube2d1 A T 10: 71,259,869 probably benign Het
Usp48 T C 4: 137,616,412 V452A probably benign Het
Vldlr T A 19: 27,239,664 I39N probably damaging Het
Wbp1l C T 19: 46,654,180 R191* probably null Het
Zyg11b C T 4: 108,237,380 W669* probably null Het
Other mutations in Fndc8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02392:Fndc8 APN 11 82898603 missense probably damaging 1.00
R0066:Fndc8 UTSW 11 82897572 missense probably benign 0.38
R0066:Fndc8 UTSW 11 82897572 missense probably benign 0.38
R1827:Fndc8 UTSW 11 82899529 missense probably damaging 0.97
R2179:Fndc8 UTSW 11 82898754 missense probably damaging 1.00
R4504:Fndc8 UTSW 11 82892400 missense probably benign 0.21
R5401:Fndc8 UTSW 11 82897850 missense possibly damaging 0.80
R5960:Fndc8 UTSW 11 82897572 missense probably benign 0.15
R6793:Fndc8 UTSW 11 82897586 missense probably damaging 1.00
R6798:Fndc8 UTSW 11 82892391 missense probably benign
R7210:Fndc8 UTSW 11 82897866 missense probably damaging 0.99
R7224:Fndc8 UTSW 11 82892325 missense probably benign 0.05
R7341:Fndc8 UTSW 11 82898777 missense possibly damaging 0.81
Predicted Primers PCR Primer
(F):5'- GCTATTGTGATGCCTCCCAAC -3'
(R):5'- CCAATGGTTCTGACCTTCAGC -3'

Sequencing Primer
(F):5'- CACATATACCATGGGCTAGGC -3'
(R):5'- GACCTTCAGCTCGCTATCTCTATG -3'
Posted On2017-02-15