Incidental Mutation 'R5927:Sin3a'
ID459956
Institutional Source Beutler Lab
Gene Symbol Sin3a
Ensembl Gene ENSMUSG00000042557
Gene Nametranscriptional regulator, SIN3A (yeast)
SynonymsSin3, mSin3A
MMRRC Submission 044122-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5927 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location57072040-57128366 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 57111111 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Methionine at position 938 (K938M)
Ref Sequence ENSEMBL: ENSMUSP00000126601 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049169] [ENSMUST00000167715] [ENSMUST00000168177] [ENSMUST00000168502] [ENSMUST00000168678]
Predicted Effect probably damaging
Transcript: ENSMUST00000049169
AA Change: K938M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000045044
Gene: ENSMUSG00000042557
AA Change: K938M

DomainStartEndE-ValueType
low complexity region 98 119 N/A INTRINSIC
Pfam:PAH 141 187 1.4e-19 PFAM
low complexity region 217 248 N/A INTRINSIC
low complexity region 267 282 N/A INTRINSIC
Pfam:PAH 322 381 1.8e-23 PFAM
Pfam:PAH 478 524 4e-16 PFAM
HDAC_interact 551 651 3.31e-61 SMART
low complexity region 834 847 N/A INTRINSIC
low complexity region 915 930 N/A INTRINSIC
low complexity region 1135 1151 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125333
Predicted Effect probably damaging
Transcript: ENSMUST00000167715
AA Change: K938M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000130641
Gene: ENSMUSG00000042557
AA Change: K938M

DomainStartEndE-ValueType
low complexity region 98 119 N/A INTRINSIC
Pfam:PAH 141 187 1.4e-19 PFAM
low complexity region 217 248 N/A INTRINSIC
low complexity region 267 282 N/A INTRINSIC
Pfam:PAH 322 381 1.8e-23 PFAM
Pfam:PAH 478 524 4e-16 PFAM
HDAC_interact 551 651 3.31e-61 SMART
low complexity region 834 847 N/A INTRINSIC
low complexity region 915 930 N/A INTRINSIC
low complexity region 1135 1151 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167963
Predicted Effect probably damaging
Transcript: ENSMUST00000168177
AA Change: K938M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000130221
Gene: ENSMUSG00000042557
AA Change: K938M

DomainStartEndE-ValueType
low complexity region 98 119 N/A INTRINSIC
Pfam:PAH 142 186 5.3e-22 PFAM
low complexity region 217 248 N/A INTRINSIC
low complexity region 267 282 N/A INTRINSIC
Pfam:PAH 323 380 9.6e-22 PFAM
Pfam:PAH 479 523 8.1e-11 PFAM
HDAC_interact 551 651 3.31e-61 SMART
low complexity region 834 847 N/A INTRINSIC
Pfam:Sin3a_C 887 1190 1.2e-93 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000168502
AA Change: K938M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000128956
Gene: ENSMUSG00000042557
AA Change: K938M

DomainStartEndE-ValueType
low complexity region 98 119 N/A INTRINSIC
Pfam:PAH 141 187 1.4e-19 PFAM
low complexity region 217 248 N/A INTRINSIC
low complexity region 267 282 N/A INTRINSIC
Pfam:PAH 322 381 1.8e-23 PFAM
Pfam:PAH 478 524 4e-16 PFAM
HDAC_interact 551 651 3.31e-61 SMART
low complexity region 834 847 N/A INTRINSIC
low complexity region 915 930 N/A INTRINSIC
low complexity region 1138 1154 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000168678
AA Change: K938M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000126601
Gene: ENSMUSG00000042557
AA Change: K938M

DomainStartEndE-ValueType
low complexity region 98 119 N/A INTRINSIC
Pfam:PAH 141 187 1.4e-19 PFAM
low complexity region 217 248 N/A INTRINSIC
low complexity region 267 282 N/A INTRINSIC
Pfam:PAH 322 381 1.8e-23 PFAM
Pfam:PAH 478 524 4e-16 PFAM
HDAC_interact 551 651 3.31e-61 SMART
low complexity region 834 847 N/A INTRINSIC
low complexity region 915 930 N/A INTRINSIC
low complexity region 1135 1151 N/A INTRINSIC
Meta Mutation Damage Score 0.316 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.0%
Validation Efficiency 100% (73/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a transcriptional regulatory protein. It contains paired amphipathic helix (PAH) domains, which are important for protein-protein interactions and may mediate repression by the Mad-Max complex. [provided by RefSeq, Jul 2008]
PHENOTYPE: Targeted disruption of this gene results in early embryonic lethality. Homozygous null MEFs display poor cell proliferation, reduced S-phase and increased G2/M fractions, a block in DNA replication, and enhanced apoptosis; however, no increase in chromosomal instability is observed. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acadm T A 3: 153,939,108 I60F probably damaging Het
Ankrd26 A G 6: 118,507,636 probably null Het
Arhgdib A T 6: 136,924,138 W198R probably damaging Het
Atad5 T A 11: 80,127,285 I1354N probably damaging Het
Ccdc146 T A 5: 21,308,621 K500* probably null Het
Cdk11b G A 4: 155,648,240 probably benign Het
Cmip A T 8: 117,257,309 T70S possibly damaging Het
Col22a1 G T 15: 72,006,966 A114E probably damaging Het
Cpeb1 T C 7: 81,361,680 D171G possibly damaging Het
Crebzf C T 7: 90,444,323 probably benign Het
Cybb C G X: 9,450,750 D246H probably benign Het
D630036H23Rik C A 12: 36,381,672 probably benign Het
Dnah5 A T 15: 28,335,718 T2277S probably benign Het
Dysf T A 6: 84,207,212 F2083Y probably damaging Het
Elavl4 T A 4: 110,290,243 probably benign Het
Elp3 A G 14: 65,582,177 Y111H probably damaging Het
Eps8l2 A T 7: 141,356,346 Q243L probably benign Het
Eri2 C A 7: 119,786,068 L403F probably damaging Het
Fgfr4 T A 13: 55,166,887 N614K probably damaging Het
Gm5108 T G 5: 67,976,871 I74S unknown Het
Gpn1 T C 5: 31,500,891 F130L probably damaging Het
Gpr176 T A 2: 118,373,040 I50F probably benign Het
Gramd1a A G 7: 31,139,821 S221P probably benign Het
Hivep3 A G 4: 120,097,108 T874A possibly damaging Het
Igkv12-40 A G 6: 69,879,399 noncoding transcript Het
Itgb2 C A 10: 77,546,034 P57T probably damaging Het
Kcmf1 T A 6: 72,843,005 D286V possibly damaging Het
Kcnt1 T A 2: 25,909,376 probably benign Het
Kif15 A G 9: 123,017,261 S76G probably benign Het
Kpna3 C T 14: 61,384,647 V223I probably damaging Het
Krt80 A G 15: 101,364,208 probably benign Het
Lama4 A G 10: 39,072,812 Y857C probably damaging Het
Lcorl G T 5: 45,725,424 probably benign Het
Map4k3 A G 17: 80,613,919 V528A probably benign Het
Mmp8 T A 9: 7,563,202 N255K possibly damaging Het
Npat A T 9: 53,562,221 K438* probably null Het
Olfr1246 T A 2: 89,591,100 N5I possibly damaging Het
P4htm T C 9: 108,597,383 Y61C probably damaging Het
Polr3h G T 15: 81,917,279 probably null Het
Prlr C T 15: 10,322,446 T176I probably benign Het
Psme4 T G 11: 30,804,294 F184V possibly damaging Het
Ptgfrn A T 3: 101,060,652 F542I possibly damaging Het
Rock1 T C 18: 10,116,792 E448G probably damaging Het
Rpf1 A T 3: 146,519,463 probably null Het
Sectm1b T C 11: 121,055,674 I132V probably benign Het
Sestd1 T A 2: 77,187,159 H688L probably benign Het
Sidt2 T C 9: 45,944,454 Y530C probably damaging Het
Sin3b C A 8: 72,749,878 R647S probably benign Het
Slc16a14 T C 1: 84,912,267 H439R possibly damaging Het
Stc1 T C 14: 69,032,373 V134A probably benign Het
Stk11ip G A 1: 75,524,691 V24I possibly damaging Het
Tbx6 G A 7: 126,784,853 A359T possibly damaging Het
Thra G A 11: 98,763,688 V295I possibly damaging Het
Tmem8 T C 17: 26,121,998 Y692H probably benign Het
Tnr T C 1: 159,912,766 M1170T probably damaging Het
Tpcn2 T A 7: 145,278,784 I112F probably damaging Het
Trdv2-2 T C 14: 53,961,541 L96P probably damaging Het
Trim24 T A 6: 37,958,569 W832R probably damaging Het
Usp4 T G 9: 108,391,760 S891A probably benign Het
Vmn1r88 A T 7: 13,178,513 R265S probably benign Het
Vmn2r118 A G 17: 55,624,494 L60S probably benign Het
Wdr74 T C 19: 8,739,833 C220R possibly damaging Het
Xpo1 A T 11: 23,268,653 probably benign Het
Xpo1 A T 11: 23,268,656 probably benign Het
Zfp850 C A 7: 27,990,195 G196V probably benign Het
Other mutations in Sin3a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00433:Sin3a APN 9 57097901 missense probably damaging 1.00
IGL00836:Sin3a APN 9 57107345 splice site probably null
IGL00913:Sin3a APN 9 57098118 missense probably benign 0.01
IGL01721:Sin3a APN 9 57095325 missense probably damaging 1.00
IGL01964:Sin3a APN 9 57107347 splice site probably benign
IGL02333:Sin3a APN 9 57107559 missense possibly damaging 0.86
IGL02673:Sin3a APN 9 57107441 missense probably damaging 0.99
Delicate UTSW 9 57103929 missense probably damaging 1.00
IGL03014:Sin3a UTSW 9 57095255 intron probably benign
R0024:Sin3a UTSW 9 57118253 intron probably benign
R0309:Sin3a UTSW 9 57110912 missense probably benign 0.00
R0511:Sin3a UTSW 9 57096895 nonsense probably null
R1205:Sin3a UTSW 9 57119175 missense probably damaging 1.00
R1365:Sin3a UTSW 9 57125203 nonsense probably null
R1496:Sin3a UTSW 9 57119158 missense possibly damaging 0.77
R1544:Sin3a UTSW 9 57103997 splice site probably benign
R1958:Sin3a UTSW 9 57105609 missense probably damaging 1.00
R1993:Sin3a UTSW 9 57101199 missense probably damaging 1.00
R2037:Sin3a UTSW 9 57096825 missense probably benign 0.14
R2065:Sin3a UTSW 9 57110800 missense possibly damaging 0.93
R2079:Sin3a UTSW 9 57089523 missense probably benign
R2193:Sin3a UTSW 9 57117477 missense possibly damaging 0.93
R3004:Sin3a UTSW 9 57096834 nonsense probably null
R3929:Sin3a UTSW 9 57118137 missense probably damaging 0.98
R4326:Sin3a UTSW 9 57095358 missense probably damaging 1.00
R4327:Sin3a UTSW 9 57095358 missense probably damaging 1.00
R4329:Sin3a UTSW 9 57095358 missense probably damaging 1.00
R4765:Sin3a UTSW 9 57096803 missense probably benign 0.14
R4806:Sin3a UTSW 9 57086742 missense probably damaging 0.99
R4979:Sin3a UTSW 9 57118076 missense probably damaging 1.00
R5018:Sin3a UTSW 9 57110891 missense probably benign 0.00
R5368:Sin3a UTSW 9 57110800 missense possibly damaging 0.93
R5379:Sin3a UTSW 9 57110988 missense probably benign 0.10
R5391:Sin3a UTSW 9 57105673 missense probably damaging 1.00
R5395:Sin3a UTSW 9 57105673 missense probably damaging 1.00
R5519:Sin3a UTSW 9 57118173 critical splice donor site probably null
R5987:Sin3a UTSW 9 57127200 missense possibly damaging 0.75
R6083:Sin3a UTSW 9 57107540 missense probably damaging 1.00
R6161:Sin3a UTSW 9 57095424 missense possibly damaging 0.48
R6196:Sin3a UTSW 9 57103929 missense probably damaging 1.00
R6374:Sin3a UTSW 9 57117481 missense probably benign
R6456:Sin3a UTSW 9 57113701 missense possibly damaging 0.79
R6815:Sin3a UTSW 9 57117540 missense probably benign 0.02
R6900:Sin3a UTSW 9 57107574 missense probably damaging 1.00
R7051:Sin3a UTSW 9 57103934 missense probably damaging 1.00
R7081:Sin3a UTSW 9 57094471 missense not run
X0026:Sin3a UTSW 9 57125192 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TGCTATTTAGTAACACAGCAGCTC -3'
(R):5'- ACAAGGTTCCATGCTTGCATC -3'

Sequencing Primer
(F):5'- TTTAGTAACACAGCAGCTCAAAAG -3'
(R):5'- CATTCATGGGTTCAAGGAAGGTTAC -3'
Posted On2017-02-28