Incidental Mutation 'R5937:Taf5'
ID462351
Institutional Source Beutler Lab
Gene Symbol Taf5
Ensembl Gene ENSMUSG00000025049
Gene NameTATA-box binding protein associated factor 5
Synonyms6330528C20Rik
MMRRC Submission 043242-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.966) question?
Stock #R5937 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location47067748-47083479 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 47081895 bp
ZygosityHeterozygous
Amino Acid Change Serine to Leucine at position 640 (S640L)
Ref Sequence ENSEMBL: ENSMUSP00000026027 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026027] [ENSMUST00000096014]
Predicted Effect probably damaging
Transcript: ENSMUST00000026027
AA Change: S640L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000026027
Gene: ENSMUSG00000025049
AA Change: S640L

DomainStartEndE-ValueType
low complexity region 15 26 N/A INTRINSIC
low complexity region 29 92 N/A INTRINSIC
LisH 93 125 6.52e-2 SMART
low complexity region 132 150 N/A INTRINSIC
Pfam:TFIID_NTD2 206 338 4.5e-55 PFAM
low complexity region 389 417 N/A INTRINSIC
WD40 460 499 8.36e-2 SMART
WD40 533 572 1.82e-11 SMART
WD40 575 614 1.19e-6 SMART
WD40 617 656 9.08e-12 SMART
WD40 659 698 1.4e-12 SMART
WD40 701 740 2.57e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000096014
SMART Domains Protein: ENSMUSP00000093713
Gene: ENSMUSG00000071528

DomainStartEndE-ValueType
Pfam:ATP_synth_reg 1 51 7.6e-33 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 97.3%
  • 20x: 91.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Initiation of transcription by RNA polymerase II requires the activities of more than 70 polypeptides. The protein that coordinates these activities is transcription factor IID (TFIID), which binds to the core promoter to position the polymerase properly, serves as the scaffold for assembly of the remainder of the transcription complex, and acts as a channel for regulatory signals. TFIID is composed of the TATA-binding protein (TBP) and a group of evolutionarily conserved proteins known as TBP-associated factors or TAFs. TAFs may participate in basal transcription, serve as coactivators, function in promoter recognition or modify general transcription factors (GTFs) to facilitate complex assembly and transcription initiation. This gene encodes an integral subunit of TFIID associated with all transcriptionally competent forms of that complex. This subunit interacts strongly with two TFIID subunits that show similarity to histones H3 and H4, and it may participate in forming a nucleosome-like core in the TFIID complex. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A1bg A T 15: 60,919,646 W314R probably benign Het
Adgrv1 A T 13: 81,107,075 V6143E probably damaging Het
Agap3 C T 5: 24,477,817 T261I probably damaging Het
Ano6 T C 15: 95,913,957 I241T probably damaging Het
Arhgef28 T C 13: 97,939,543 T1328A probably benign Het
Capn10 C T 1: 92,939,383 R112W probably damaging Het
Car5a A T 8: 121,939,821 W46R probably damaging Het
Cntn6 C A 6: 104,833,103 T582K possibly damaging Het
Ctsh T C 9: 90,061,456 V60A probably benign Het
Ctsll3 A G 13: 60,799,596 F259L probably damaging Het
Fam228a T C 12: 4,737,725 E16G probably damaging Het
G3bp2 A G 5: 92,055,397 I388T probably damaging Het
Galnt5 A T 2: 58,038,937 K926N probably benign Het
Gm10097 G A 10: 5,069,485 probably benign Het
Gm9978 T A 10: 78,486,841 noncoding transcript Het
Gria1 A G 11: 57,189,733 T112A probably benign Het
Hnrnpk A C 13: 58,395,202 V134G probably damaging Het
Insr A G 8: 3,174,808 V220A probably benign Het
Lhx4 A G 1: 155,710,277 I96T probably damaging Het
Lrp1 T C 10: 127,583,876 T955A possibly damaging Het
Lrtm1 T C 14: 29,021,830 V85A possibly damaging Het
Man2a2 T C 7: 80,363,503 Y514C probably damaging Het
Npas1 T A 7: 16,463,262 D226V probably benign Het
Nrcam G A 12: 44,572,291 V858I probably benign Het
Olfr1462 T A 19: 13,191,311 S215T probably damaging Het
Olfr293 G T 7: 86,664,476 L271F probably benign Het
Pde6b G T 5: 108,424,327 A478S probably benign Het
Pex1 T A 5: 3,624,487 N789K possibly damaging Het
Plekha6 A G 1: 133,260,101 D120G possibly damaging Het
Pomgnt1 A G 4: 116,153,913 T220A probably benign Het
Sdr39u1 A T 14: 55,897,907 I193K probably damaging Het
Sec61a2 C A 2: 5,886,557 M54I probably benign Het
Sema5a A G 15: 32,574,841 Y365C probably damaging Het
Sra1 C T 18: 36,671,599 probably null Het
St5 A T 7: 109,557,271 C91S possibly damaging Het
Tas2r140 T A 6: 133,055,273 H174L probably benign Het
Tmem63a T A 1: 180,961,151 V351D probably damaging Het
Ttll7 C T 3: 146,944,092 Q626* probably null Het
Ubn2 T A 6: 38,463,982 V263E possibly damaging Het
Vmn2r106 C T 17: 20,285,405 W9* probably null Het
Xrcc3 C G 12: 111,807,972 C141S probably null Het
Zfp516 T A 18: 82,956,833 D385E probably damaging Het
Other mutations in Taf5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00672:Taf5 APN 19 47082301 missense probably damaging 1.00
IGL01115:Taf5 APN 19 47075082 missense probably benign 0.01
IGL02168:Taf5 APN 19 47082478 missense probably damaging 0.98
IGL02638:Taf5 APN 19 47068210 missense probably benign 0.00
IGL02689:Taf5 APN 19 47077265 splice site probably benign
R0008:Taf5 UTSW 19 47075862 missense possibly damaging 0.94
R0008:Taf5 UTSW 19 47075862 missense possibly damaging 0.94
R0220:Taf5 UTSW 19 47080560 missense probably damaging 1.00
R0685:Taf5 UTSW 19 47074854 missense probably benign 0.10
R1518:Taf5 UTSW 19 47081846 missense probably damaging 1.00
R2329:Taf5 UTSW 19 47075124 missense probably benign 0.07
R3431:Taf5 UTSW 19 47075833 missense probably damaging 1.00
R3432:Taf5 UTSW 19 47075833 missense probably damaging 1.00
R3689:Taf5 UTSW 19 47078785 missense probably damaging 0.99
R4411:Taf5 UTSW 19 47071014 missense probably damaging 1.00
R4413:Taf5 UTSW 19 47071014 missense probably damaging 1.00
R4676:Taf5 UTSW 19 47074970 missense probably damaging 1.00
R5370:Taf5 UTSW 19 47075764 missense probably damaging 0.99
R5875:Taf5 UTSW 19 47076110 missense probably damaging 1.00
R5883:Taf5 UTSW 19 47067789 missense unknown
R6835:Taf5 UTSW 19 47077337 missense possibly damaging 0.94
R7007:Taf5 UTSW 19 47071211 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGTTAGAGGAACCATTTGGAATTG -3'
(R):5'- CGAGCAAAGTAGGGTTAAATCTATCTG -3'

Sequencing Primer
(F):5'- GGAATTGATCTTCACCTGGAAATACC -3'
(R):5'- TGACATACCTTGTGCCCA -3'
Posted On2017-02-28