Incidental Mutation 'R6005:Ankrd2'
ID479457
Institutional Source Beutler Lab
Gene Symbol Ankrd2
Ensembl Gene ENSMUSG00000025172
Gene Nameankyrin repeat domain 2 (stretch responsive muscle)
SynonymsmArpp, Arpp
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6005 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location42036038-42045110 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 42040115 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 70 (D70G)
Ref Sequence ENSEMBL: ENSMUSP00000026172 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026172]
Predicted Effect probably damaging
Transcript: ENSMUST00000026172
AA Change: D70G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000026172
Gene: ENSMUSG00000025172
AA Change: D70G

DomainStartEndE-ValueType
low complexity region 104 111 N/A INTRINSIC
ANK 149 178 5.24e-4 SMART
ANK 182 211 5.79e-6 SMART
ANK 215 244 1.33e-5 SMART
ANK 248 277 3.18e-3 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 97.2%
  • 20x: 90.9%
Validation Efficiency 99% (79/80)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the muscle ankyrin repeat protein (MARP) family. A similar gene in rodents is a component of a muscle stress response pathway and plays a role in the stretch-response associated with slow muscle function. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Mar 2014]
PHENOTYPE: Mice homozygous for a null allele are viable, fertile and free of cardiac defects but exhibit altered inflammatory responses and are prone to skeletal muscle fiber-type switching of slow fibers toward a faster phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810006K23Rik G T 5: 124,340,774 E153* probably null Het
4930412O13Rik T C 2: 9,882,827 probably benign Het
7530416G11Rik A T 15: 85,494,109 I111N unknown Het
Adgb C T 10: 10,395,352 R849H probably damaging Het
Ahnak T C 19: 9,015,161 V4603A possibly damaging Het
AI464131 T A 4: 41,498,895 H245L probably benign Het
Ank1 A G 8: 23,132,202 D1589G probably damaging Het
Arid2 T C 15: 96,370,972 S989P probably benign Het
Bbs1 A T 19: 4,903,795 Y113* probably null Het
Bfsp2 T G 9: 103,448,550 K298T probably damaging Het
Bpi G A 2: 158,262,480 V168I possibly damaging Het
Cacna2d1 T C 5: 16,361,821 S921P probably damaging Het
Clec4d A C 6: 123,267,159 T76P probably damaging Het
Coq8b C T 7: 27,257,325 Q468* probably null Het
Dennd6b T C 15: 89,188,168 E248G possibly damaging Het
Ednra A G 8: 77,674,927 S245P possibly damaging Het
Epb41l4a C T 18: 33,828,143 C446Y probably benign Het
Fam221a A G 6: 49,367,822 probably benign Het
Fam229a T C 4: 129,491,503 S76P probably benign Het
Fryl C T 5: 73,083,295 D1321N probably damaging Het
Gli2 C T 1: 118,842,064 R586H probably damaging Het
Gm13089 T A 4: 143,698,432 H147L probably benign Het
Gm94 C T 18: 43,792,797 A16T possibly damaging Het
Gorasp2 T C 2: 70,690,751 V355A probably benign Het
Grid1 C A 14: 35,323,412 T404N probably damaging Het
Gtf2i C A 5: 134,255,958 E475* probably null Het
Gucy1a2 T C 9: 3,865,518 probably null Het
Hs3st5 T A 10: 36,832,928 I153N probably damaging Het
Il11ra1 T C 4: 41,763,887 probably null Het
Ireb2 G A 9: 54,908,805 G887S probably damaging Het
Kdsr T C 1: 106,734,581 E248G probably benign Het
Lemd2 C G 17: 27,190,785 R464P probably damaging Het
Lrrfip1 T C 1: 91,114,611 V246A probably damaging Het
Macf1 T A 4: 123,474,275 D2231V possibly damaging Het
Map2k5 C T 9: 63,281,019 D283N probably damaging Het
Mfsd5 A G 15: 102,281,492 D433G possibly damaging Het
Mir700 C A 4: 135,412,307 probably null Het
Mroh9 A T 1: 163,075,677 F52L probably damaging Het
Mycbp2 A C 14: 103,156,723 S2691A probably benign Het
Nktr T A 9: 121,748,394 probably benign Het
Obsl1 C A 1: 75,492,215 probably null Het
Olfr1130 A T 2: 87,608,080 I231F probably damaging Het
Olfr251 T C 9: 38,378,309 S137P probably damaging Het
Olfr259 A G 2: 87,108,063 V108A probably benign Het
Olfr582 A T 7: 103,041,646 I51F probably damaging Het
Olfr855 C T 9: 19,584,885 T116I probably benign Het
Pcdhb22 T A 18: 37,519,736 I162N possibly damaging Het
Pde1c A T 6: 56,479,202 probably null Het
Pds5b A G 5: 150,769,776 probably null Het
Pkd1l1 A C 11: 8,857,113 W1568G probably damaging Het
Polr3c A T 3: 96,719,468 M258K possibly damaging Het
Prss12 A T 3: 123,482,768 I349F probably benign Het
Ptpn21 A G 12: 98,678,552 *1177Q probably null Het
Rgs22 T A 15: 36,010,567 K1125M probably benign Het
Rnf182 A G 13: 43,668,035 K21E probably damaging Het
Rpl6 G A 5: 121,205,514 probably benign Het
Samsn1 C T 16: 75,873,514 V234I probably benign Het
Scrib A G 15: 76,057,751 I1089T probably damaging Het
Sec31a T C 5: 100,363,878 T1092A probably damaging Het
Sh3bp2 G T 5: 34,562,465 R606L possibly damaging Het
Sipa1 A G 19: 5,656,201 V367A probably damaging Het
Slc25a44 C T 3: 88,412,846 E269K probably damaging Het
Slc44a4 T A 17: 34,923,454 M353K possibly damaging Het
Sorcs2 A G 5: 36,019,384 S1142P probably damaging Het
Sptbn4 A G 7: 27,418,599 F352L probably damaging Het
Synj1 A T 16: 90,969,286 N541K probably damaging Het
Tas2r113 G A 6: 132,893,696 R229K probably benign Het
Tcaf3 A T 6: 42,589,971 I728K probably benign Het
Tcea1 A G 1: 4,890,773 E167G probably benign Het
Timeless G A 10: 128,244,200 R406H probably damaging Het
Traf6 C T 2: 101,696,684 R260* probably null Het
Traj31 C T 14: 54,187,931 probably benign Het
Ttn A T 2: 76,769,563 V19089D probably damaging Het
Unc80 C T 1: 66,627,257 S1868L possibly damaging Het
Wdr38 A T 2: 39,001,321 I287F possibly damaging Het
Wnt2 G A 6: 18,030,323 probably benign Het
Wnt5b G A 6: 119,433,654 P288L probably benign Het
Xkr5 G T 8: 18,934,505 N174K probably benign Het
Zbtb6 C T 2: 37,428,965 R317Q probably damaging Het
Zcchc7 AGGGG AGGG 4: 44,931,218 probably null Het
Zfp647 G A 15: 76,912,085 P125L probably damaging Het
Other mutations in Ankrd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01529:Ankrd2 APN 19 42039910 missense probably damaging 0.97
IGL03088:Ankrd2 APN 19 42041985 missense probably null 0.01
IGL03050:Ankrd2 UTSW 19 42040094 missense probably damaging 1.00
R0133:Ankrd2 UTSW 19 42044071 missense probably benign 0.01
R0930:Ankrd2 UTSW 19 42043853 critical splice donor site probably null
R2135:Ankrd2 UTSW 19 42044059 missense probably damaging 1.00
R2204:Ankrd2 UTSW 19 42044119 missense probably damaging 0.98
R2205:Ankrd2 UTSW 19 42044119 missense probably damaging 0.98
R4529:Ankrd2 UTSW 19 42043801 missense probably benign 0.05
R4833:Ankrd2 UTSW 19 42043857 splice site probably null
R5112:Ankrd2 UTSW 19 42039887 missense possibly damaging 0.71
R6146:Ankrd2 UTSW 19 42040105 missense possibly damaging 0.57
X0063:Ankrd2 UTSW 19 42042403 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CAGAGTCCTGCTTTACAAAAGG -3'
(R):5'- TCTGCAGGTAGAACATCCGC -3'

Sequencing Primer
(F):5'- GAGTCCTGCTTTACAAAAGGTTAAGG -3'
(R):5'- ATAAAGGGAGCTTCCGGGCC -3'
Posted On2017-06-26