Incidental Mutation 'R6087:Zc3h13'
ID484623
Institutional Source Beutler Lab
Gene Symbol Zc3h13
Ensembl Gene ENSMUSG00000022000
Gene Namezinc finger CCCH type containing 13
Synonyms4930570G11Rik, 3110050K21Rik, 2600010B19Rik, C87618
MMRRC Submission 044244-MU
Accession Numbers

Genbank: NM_026083

Is this an essential gene? Probably essential (E-score: 0.965) question?
Stock #R6087 (G1)
Quality Score225.009
Status Not validated
Chromosome14
Chromosomal Location75284373-75344426 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 75330709 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 1147 (D1147E)
Ref Sequence ENSEMBL: ENSMUSP00000022577 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022577] [ENSMUST00000227049]
Predicted Effect probably damaging
Transcript: ENSMUST00000022577
AA Change: D1147E

PolyPhen 2 Score 0.964 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000022577
Gene: ENSMUSG00000022000
AA Change: D1147E

DomainStartEndE-ValueType
ZnF_C3H1 36 63 4.54e-4 SMART
low complexity region 136 145 N/A INTRINSIC
coiled coil region 162 197 N/A INTRINSIC
low complexity region 204 233 N/A INTRINSIC
low complexity region 261 269 N/A INTRINSIC
low complexity region 278 287 N/A INTRINSIC
low complexity region 321 357 N/A INTRINSIC
low complexity region 411 478 N/A INTRINSIC
low complexity region 482 493 N/A INTRINSIC
low complexity region 496 575 N/A INTRINSIC
low complexity region 684 701 N/A INTRINSIC
coiled coil region 706 865 N/A INTRINSIC
low complexity region 907 918 N/A INTRINSIC
internal_repeat_1 921 948 1.8e-6 PROSPERO
low complexity region 964 985 N/A INTRINSIC
low complexity region 1032 1052 N/A INTRINSIC
low complexity region 1071 1087 N/A INTRINSIC
low complexity region 1160 1218 N/A INTRINSIC
low complexity region 1253 1265 N/A INTRINSIC
internal_repeat_1 1273 1301 1.8e-6 PROSPERO
low complexity region 1325 1349 N/A INTRINSIC
low complexity region 1366 1391 N/A INTRINSIC
low complexity region 1400 1425 N/A INTRINSIC
low complexity region 1431 1442 N/A INTRINSIC
low complexity region 1690 1697 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000227049
AA Change: D1147E
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.2%
Validation Efficiency
Allele List at MGI

All alleles(11) : Targeted, other(2) Gene trapped(9) 

Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310003L06Rik A G 5: 87,971,762 K126R possibly damaging Het
9330182L06Rik T C 5: 9,399,255 S128P probably damaging Het
Adam7 A T 14: 68,510,757 C548S probably damaging Het
Adar C A 3: 89,745,590 H260N probably benign Het
Ak9 A G 10: 41,382,832 E775G probably benign Het
Arhgap35 T C 7: 16,563,643 Y499C probably damaging Het
Bank1 A G 3: 136,066,429 L480P probably damaging Het
Cep135 G T 5: 76,615,791 probably null Het
Cnga1 G T 5: 72,610,812 A177E probably damaging Het
Cubn T A 2: 13,427,847 D1221V probably damaging Het
Cyp2d40 T C 15: 82,764,004 Y36C possibly damaging Het
Dock8 C A 19: 25,161,074 N1254K probably benign Het
Fam13b C T 18: 34,487,139 V231I possibly damaging Het
Fbxo8 T A 8: 56,569,318 Y122N probably damaging Het
Fmo2 T A 1: 162,880,433 I378F probably benign Het
Golga3 A T 5: 110,204,946 Q861L probably damaging Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Ighv3-8 G T 12: 114,322,380 A114E probably damaging Het
Itga3 C T 11: 95,052,443 probably null Het
Kank1 G A 19: 25,409,724 V254I probably benign Het
Lipo5 A T 19: 33,465,975 I147K unknown Het
Lrfn2 A G 17: 49,071,126 S412G probably benign Het
Lrrn3 T C 12: 41,453,535 N261S possibly damaging Het
Mical2 C T 7: 112,318,485 Q350* probably null Het
Nras T C 3: 103,060,321 F78L probably damaging Het
Nudt9 A G 5: 104,050,813 I65V probably benign Het
Olfr1129 A G 2: 87,575,915 D277G probably benign Het
Olfr1293-ps A T 2: 111,528,181 E289V possibly damaging Het
Oscar G A 7: 3,611,312 P143S probably benign Het
Pla2g4d C T 2: 120,270,006 G615D probably damaging Het
Plekha1 T G 7: 130,900,571 S175A probably benign Het
Psg27 T C 7: 18,556,944 K445E probably benign Het
Rad51c A G 11: 87,380,879 Y318H probably benign Het
Ret G T 6: 118,176,291 T472K possibly damaging Het
Tarbp1 T C 8: 126,428,970 D1343G probably benign Het
Top2b C A 14: 16,409,864 R844S probably benign Het
Vmn1r171 T A 7: 23,633,004 M218K probably damaging Het
Vmn2r89 A T 14: 51,457,576 probably null Het
Zgrf1 T A 3: 127,615,486 L1703H probably damaging Het
Other mutations in Zc3h13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00945:Zc3h13 APN 14 75330147 missense probably damaging 0.99
IGL01129:Zc3h13 APN 14 75335999 missense probably damaging 1.00
IGL01599:Zc3h13 APN 14 75309723 missense probably damaging 1.00
IGL01844:Zc3h13 APN 14 75343769 utr 3 prime probably benign
IGL02132:Zc3h13 APN 14 75330347 missense probably benign 0.10
IGL03108:Zc3h13 APN 14 75331766 missense possibly damaging 0.73
IGL03299:Zc3h13 APN 14 75293941 missense probably damaging 1.00
IGL03377:Zc3h13 APN 14 75293976 missense possibly damaging 0.53
B5639:Zc3h13 UTSW 14 75316039 missense probably damaging 1.00
FR4304:Zc3h13 UTSW 14 75323603 small insertion probably benign
FR4304:Zc3h13 UTSW 14 75323610 small insertion probably benign
FR4340:Zc3h13 UTSW 14 75323592 small insertion probably benign
FR4449:Zc3h13 UTSW 14 75323601 nonsense probably null
FR4548:Zc3h13 UTSW 14 75323599 small insertion probably benign
FR4589:Zc3h13 UTSW 14 75323592 small insertion probably benign
FR4589:Zc3h13 UTSW 14 75323597 small insertion probably benign
FR4589:Zc3h13 UTSW 14 75323598 small insertion probably benign
FR4737:Zc3h13 UTSW 14 75323596 small insertion probably benign
FR4737:Zc3h13 UTSW 14 75323599 small insertion probably benign
PIT4696001:Zc3h13 UTSW 14 75331883 missense probably damaging 1.00
R0103:Zc3h13 UTSW 14 75330468 missense probably damaging 0.98
R0103:Zc3h13 UTSW 14 75330468 missense probably damaging 0.98
R0127:Zc3h13 UTSW 14 75323254 missense unknown
R0374:Zc3h13 UTSW 14 75308965 missense probably damaging 1.00
R0396:Zc3h13 UTSW 14 75323482 missense unknown
R0408:Zc3h13 UTSW 14 75292186 nonsense probably null
R0967:Zc3h13 UTSW 14 75343739 missense possibly damaging 0.54
R1006:Zc3h13 UTSW 14 75330549 missense probably damaging 0.99
R1142:Zc3h13 UTSW 14 75315984 missense probably benign 0.14
R1605:Zc3h13 UTSW 14 75337483 nonsense probably null
R2021:Zc3h13 UTSW 14 75330195 missense probably damaging 0.96
R2270:Zc3h13 UTSW 14 75332147 missense probably benign 0.03
R3508:Zc3h13 UTSW 14 75308940 nonsense probably null
R3745:Zc3h13 UTSW 14 75330661 missense probably benign 0.03
R3954:Zc3h13 UTSW 14 75329738 missense possibly damaging 0.85
R4205:Zc3h13 UTSW 14 75327601 missense unknown
R4799:Zc3h13 UTSW 14 75339423 missense probably damaging 1.00
R5042:Zc3h13 UTSW 14 75339396 missense probably damaging 0.98
R5133:Zc3h13 UTSW 14 75336009 missense probably damaging 1.00
R5384:Zc3h13 UTSW 14 75343619 missense probably benign 0.14
R5432:Zc3h13 UTSW 14 75331247 missense probably damaging 1.00
R5611:Zc3h13 UTSW 14 75330908 missense probably benign 0.10
R5687:Zc3h13 UTSW 14 75331960 nonsense probably null
R5726:Zc3h13 UTSW 14 75330829 missense possibly damaging 0.84
R5817:Zc3h13 UTSW 14 75328132 missense probably damaging 0.96
R6224:Zc3h13 UTSW 14 75337409 missense probably damaging 0.99
R6247:Zc3h13 UTSW 14 75343736 missense probably benign 0.14
R6278:Zc3h13 UTSW 14 75330423 missense probably benign 0.01
R6315:Zc3h13 UTSW 14 75308915 missense probably damaging 1.00
R6490:Zc3h13 UTSW 14 75323558 small deletion probably benign
R6598:Zc3h13 UTSW 14 75332183 missense probably damaging 0.99
R7051:Zc3h13 UTSW 14 75331157 missense probably damaging 1.00
R7054:Zc3h13 UTSW 14 75321787 missense probably benign 0.19
R7135:Zc3h13 UTSW 14 75321721 missense unknown
R7307:Zc3h13 UTSW 14 75330541 missense probably damaging 0.96
R7515:Zc3h13 UTSW 14 75308909 missense unknown
Predicted Primers PCR Primer
(F):5'- CCAAGGGTGATTCTGATGTTTC -3'
(R):5'- TCACTGCCATTGGTATTGGAGG -3'

Sequencing Primer
(F):5'- TTTCTGATGAGGAGGCAGCCC -3'
(R):5'- GGTGGCAGCAGAGCTTG -3'
Posted On2017-08-16