Incidental Mutation 'R6087:Kank1'
ID 484628
Institutional Source Beutler Lab
Gene Symbol Kank1
Ensembl Gene ENSMUSG00000032702
Gene Name KN motif and ankyrin repeat domains 1
Synonyms Ankrd15, D330024H06Rik, A930031B09Rik
MMRRC Submission 044244-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R6087 (G1)
Quality Score 225.009
Status Not validated
Chromosome 19
Chromosomal Location 25214339-25411860 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 25387088 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Isoleucine at position 254 (V254I)
Ref Sequence ENSEMBL: ENSMUSP00000116660 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049400] [ENSMUST00000146647]
AlphaFold E9Q238
Predicted Effect probably benign
Transcript: ENSMUST00000049400
AA Change: V226I

PolyPhen 2 Score 0.177 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000042177
Gene: ENSMUSG00000032702
AA Change: V226I

DomainStartEndE-ValueType
Pfam:KN_motif 30 68 3.3e-24 PFAM
low complexity region 88 105 N/A INTRINSIC
low complexity region 138 148 N/A INTRINSIC
coiled coil region 286 314 N/A INTRINSIC
low complexity region 350 358 N/A INTRINSIC
coiled coil region 362 395 N/A INTRINSIC
coiled coil region 451 494 N/A INTRINSIC
low complexity region 541 556 N/A INTRINSIC
low complexity region 617 629 N/A INTRINSIC
Blast:ANK 963 993 7e-10 BLAST
low complexity region 1010 1030 N/A INTRINSIC
low complexity region 1074 1095 N/A INTRINSIC
ANK 1169 1199 3.71e-4 SMART
ANK 1203 1236 2.27e1 SMART
ANK 1241 1270 1.33e-5 SMART
ANK 1274 1306 5.84e-2 SMART
ANK 1308 1336 4.86e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137260
Predicted Effect probably benign
Transcript: ENSMUST00000146647
AA Change: V254I

PolyPhen 2 Score 0.405 (Sensitivity: 0.89; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000116660
Gene: ENSMUSG00000032702
AA Change: V254I

DomainStartEndE-ValueType
Pfam:KN_motif 58 96 2e-25 PFAM
low complexity region 116 133 N/A INTRINSIC
low complexity region 166 176 N/A INTRINSIC
coiled coil region 314 342 N/A INTRINSIC
low complexity region 378 386 N/A INTRINSIC
coiled coil region 390 423 N/A INTRINSIC
internal_repeat_1 430 479 3.72e-5 PROSPERO
low complexity region 569 584 N/A INTRINSIC
internal_repeat_1 587 636 3.72e-5 PROSPERO
low complexity region 645 657 N/A INTRINSIC
Blast:ANK 991 1021 4e-10 BLAST
low complexity region 1038 1058 N/A INTRINSIC
low complexity region 1102 1123 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the Kank family of proteins, which contain multiple ankyrin repeat domains. This family member functions in cytoskeleton formation by regulating actin polymerization. This gene is a candidate tumor suppressor for renal cell carcinoma. Mutations in this gene cause cerebral palsy spastic quadriplegic type 2, a central nervous system development disorder. A t(5;9) translocation results in fusion of the platelet-derived growth factor receptor beta gene (PDGFRB) on chromosome 5 with this gene in a myeloproliferative neoplasm featuring severe thrombocythemia. Alternative splicing of this gene results in multiple transcript variants. A related pseudogene has been identified on chromosome 20. [provided by RefSeq, Dec 2014]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310003L06Rik A G 5: 88,119,621 (GRCm39) K126R possibly damaging Het
Adam7 A T 14: 68,748,206 (GRCm39) C548S probably damaging Het
Adar C A 3: 89,652,897 (GRCm39) H260N probably benign Het
Ak9 A G 10: 41,258,828 (GRCm39) E775G probably benign Het
Arhgap35 T C 7: 16,297,568 (GRCm39) Y499C probably damaging Het
Bank1 A G 3: 135,772,190 (GRCm39) L480P probably damaging Het
Cep135 G T 5: 76,763,638 (GRCm39) probably null Het
Cnga1 G T 5: 72,768,155 (GRCm39) A177E probably damaging Het
Cubn T A 2: 13,432,658 (GRCm39) D1221V probably damaging Het
Cyp2d40 T C 15: 82,648,205 (GRCm39) Y36C possibly damaging Het
Dock8 C A 19: 25,138,438 (GRCm39) N1254K probably benign Het
Elapor2 T C 5: 9,449,255 (GRCm39) S128P probably damaging Het
Fam13b C T 18: 34,620,192 (GRCm39) V231I possibly damaging Het
Fbxo8 T A 8: 57,022,353 (GRCm39) Y122N probably damaging Het
Fmo2 T A 1: 162,708,002 (GRCm39) I378F probably benign Het
Golga3 A T 5: 110,352,812 (GRCm39) Q861L probably damaging Het
Hjurp GT GTT 1: 88,194,246 (GRCm39) probably null Het
Ighv3-8 G T 12: 114,286,000 (GRCm39) A114E probably damaging Het
Itga3 C T 11: 94,943,269 (GRCm39) probably null Het
Lipo5 A T 19: 33,443,375 (GRCm39) I147K unknown Het
Lrfn2 A G 17: 49,378,154 (GRCm39) S412G probably benign Het
Lrrn3 T C 12: 41,503,534 (GRCm39) N261S possibly damaging Het
Mical2 C T 7: 111,917,692 (GRCm39) Q350* probably null Het
Nras T C 3: 102,967,637 (GRCm39) F78L probably damaging Het
Nudt9 A G 5: 104,198,679 (GRCm39) I65V probably benign Het
Or10ag59 A G 2: 87,406,259 (GRCm39) D277G probably benign Het
Or4f17-ps1 A T 2: 111,358,526 (GRCm39) E289V possibly damaging Het
Oscar G A 7: 3,614,311 (GRCm39) P143S probably benign Het
Pla2g4d C T 2: 120,100,487 (GRCm39) G615D probably damaging Het
Plekha1 T G 7: 130,502,301 (GRCm39) S175A probably benign Het
Psg27 T C 7: 18,290,869 (GRCm39) K445E probably benign Het
Rad51c A G 11: 87,271,705 (GRCm39) Y318H probably benign Het
Ret G T 6: 118,153,252 (GRCm39) T472K possibly damaging Het
Tarbp1 T C 8: 127,155,709 (GRCm39) D1343G probably benign Het
Top2b C A 14: 16,409,864 (GRCm38) R844S probably benign Het
Vmn1r171 T A 7: 23,332,429 (GRCm39) M218K probably damaging Het
Vmn2r89 A T 14: 51,695,033 (GRCm39) probably null Het
Zc3h13 T A 14: 75,568,149 (GRCm39) D1147E probably damaging Het
Zgrf1 T A 3: 127,409,135 (GRCm39) L1703H probably damaging Het
Other mutations in Kank1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00324:Kank1 APN 19 25,389,122 (GRCm39) missense probably benign
IGL00435:Kank1 APN 19 25,407,600 (GRCm39) missense probably benign 0.41
IGL01105:Kank1 APN 19 25,401,680 (GRCm39) missense possibly damaging 0.80
IGL01974:Kank1 APN 19 25,387,596 (GRCm39) missense possibly damaging 0.87
IGL02031:Kank1 APN 19 25,388,066 (GRCm39) missense probably benign 0.01
IGL02125:Kank1 APN 19 25,388,067 (GRCm39) missense possibly damaging 0.90
IGL02152:Kank1 APN 19 25,405,536 (GRCm39) missense possibly damaging 0.51
IGL02211:Kank1 APN 19 25,407,702 (GRCm39) missense probably damaging 1.00
IGL02440:Kank1 APN 19 25,410,272 (GRCm39) missense probably damaging 1.00
IGL02448:Kank1 APN 19 25,388,739 (GRCm39) missense probably damaging 1.00
IGL02671:Kank1 APN 19 25,405,459 (GRCm39) missense probably damaging 1.00
IGL03102:Kank1 APN 19 25,403,282 (GRCm39) missense probably damaging 1.00
IGL03259:Kank1 APN 19 25,407,705 (GRCm39) missense probably damaging 1.00
IGL02802:Kank1 UTSW 19 25,388,963 (GRCm39) missense probably damaging 1.00
R0107:Kank1 UTSW 19 25,407,730 (GRCm39) unclassified probably benign
R0190:Kank1 UTSW 19 25,386,647 (GRCm39) missense probably benign 0.00
R0330:Kank1 UTSW 19 25,401,677 (GRCm39) missense probably benign 0.00
R0368:Kank1 UTSW 19 25,387,967 (GRCm39) nonsense probably null
R0399:Kank1 UTSW 19 25,388,606 (GRCm39) missense probably benign 0.00
R0426:Kank1 UTSW 19 25,388,837 (GRCm39) missense probably damaging 1.00
R0483:Kank1 UTSW 19 25,403,357 (GRCm39) unclassified probably benign
R1394:Kank1 UTSW 19 25,405,528 (GRCm39) missense probably damaging 1.00
R1495:Kank1 UTSW 19 25,387,713 (GRCm39) missense probably damaging 0.98
R1681:Kank1 UTSW 19 25,387,668 (GRCm39) missense possibly damaging 0.89
R1698:Kank1 UTSW 19 25,388,681 (GRCm39) missense probably benign 0.11
R1830:Kank1 UTSW 19 25,388,396 (GRCm39) missense probably benign 0.00
R1866:Kank1 UTSW 19 25,388,813 (GRCm39) missense probably benign 0.04
R2138:Kank1 UTSW 19 25,389,117 (GRCm39) missense probably benign 0.00
R2139:Kank1 UTSW 19 25,389,117 (GRCm39) missense probably benign 0.00
R2420:Kank1 UTSW 19 25,387,821 (GRCm39) missense probably damaging 1.00
R3153:Kank1 UTSW 19 25,388,052 (GRCm39) missense possibly damaging 0.89
R4164:Kank1 UTSW 19 25,388,436 (GRCm39) missense probably benign 0.10
R4670:Kank1 UTSW 19 25,387,944 (GRCm39) missense probably benign 0.00
R4685:Kank1 UTSW 19 25,387,398 (GRCm39) missense possibly damaging 0.66
R4843:Kank1 UTSW 19 25,408,371 (GRCm39) missense probably damaging 1.00
R4981:Kank1 UTSW 19 25,388,759 (GRCm39) missense probably benign 0.19
R5189:Kank1 UTSW 19 25,401,545 (GRCm39) missense probably damaging 1.00
R5280:Kank1 UTSW 19 25,388,669 (GRCm39) missense probably benign 0.01
R5330:Kank1 UTSW 19 25,388,693 (GRCm39) missense probably damaging 1.00
R5331:Kank1 UTSW 19 25,388,693 (GRCm39) missense probably damaging 1.00
R5435:Kank1 UTSW 19 25,388,507 (GRCm39) missense probably benign 0.04
R5500:Kank1 UTSW 19 25,401,696 (GRCm39) missense possibly damaging 0.46
R5894:Kank1 UTSW 19 25,401,564 (GRCm39) missense probably damaging 1.00
R6357:Kank1 UTSW 19 25,388,717 (GRCm39) missense probably benign 0.36
R6490:Kank1 UTSW 19 25,387,449 (GRCm39) missense probably damaging 1.00
R6504:Kank1 UTSW 19 25,405,518 (GRCm39) missense probably damaging 1.00
R6942:Kank1 UTSW 19 25,401,537 (GRCm39) missense possibly damaging 0.88
R7037:Kank1 UTSW 19 25,407,705 (GRCm39) missense probably damaging 1.00
R7405:Kank1 UTSW 19 25,387,683 (GRCm39) nonsense probably null
R7486:Kank1 UTSW 19 25,388,193 (GRCm39) missense probably damaging 0.99
R7602:Kank1 UTSW 19 25,399,525 (GRCm39) missense probably benign 0.01
R7701:Kank1 UTSW 19 25,389,129 (GRCm39) critical splice donor site probably null
R7765:Kank1 UTSW 19 25,388,569 (GRCm39) frame shift probably null
R7766:Kank1 UTSW 19 25,388,569 (GRCm39) frame shift probably null
R7768:Kank1 UTSW 19 25,388,569 (GRCm39) frame shift probably null
R7919:Kank1 UTSW 19 25,408,439 (GRCm39) missense probably damaging 1.00
R7974:Kank1 UTSW 19 25,401,584 (GRCm39) missense probably damaging 1.00
R7978:Kank1 UTSW 19 25,388,569 (GRCm39) frame shift probably null
R8017:Kank1 UTSW 19 25,388,569 (GRCm39) frame shift probably null
R8017:Kank1 UTSW 19 25,388,568 (GRCm39) frame shift probably null
R8020:Kank1 UTSW 19 25,388,569 (GRCm39) frame shift probably null
R8150:Kank1 UTSW 19 25,388,163 (GRCm39) missense possibly damaging 0.88
R8322:Kank1 UTSW 19 25,355,842 (GRCm39) start gained probably benign
R8374:Kank1 UTSW 19 25,389,005 (GRCm39) missense probably damaging 0.97
R8705:Kank1 UTSW 19 25,388,907 (GRCm39) missense probably damaging 1.00
R8855:Kank1 UTSW 19 25,388,702 (GRCm39) missense possibly damaging 0.87
R8866:Kank1 UTSW 19 25,388,702 (GRCm39) missense possibly damaging 0.87
R8891:Kank1 UTSW 19 25,387,439 (GRCm39) missense probably benign 0.32
R8894:Kank1 UTSW 19 25,408,378 (GRCm39) missense probably damaging 1.00
R8917:Kank1 UTSW 19 25,386,928 (GRCm39) missense probably damaging 0.99
R9217:Kank1 UTSW 19 25,386,944 (GRCm39) missense possibly damaging 0.92
R9301:Kank1 UTSW 19 25,388,798 (GRCm39) missense probably benign 0.00
R9431:Kank1 UTSW 19 25,387,866 (GRCm39) missense probably damaging 1.00
R9603:Kank1 UTSW 19 25,408,289 (GRCm39) missense possibly damaging 0.95
R9680:Kank1 UTSW 19 25,388,138 (GRCm39) missense probably damaging 1.00
R9746:Kank1 UTSW 19 25,386,872 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGACGTTGATGGAGACCCG -3'
(R):5'- CAAGACGGAGATCTTGACCTGG -3'

Sequencing Primer
(F):5'- TGGAACAGGAGCGAGTCACC -3'
(R):5'- GAGATCTTGACCTGGAGCAC -3'
Posted On 2017-08-16