Incidental Mutation 'R6116:Lpar3'
ID485109
Institutional Source Beutler Lab
Gene Symbol Lpar3
Ensembl Gene ENSMUSG00000036832
Gene Namelysophosphatidic acid receptor 3
SynonymsEdg7, LPA3
MMRRC Submission 044265-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6116 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location146220963-146286186 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 146240597 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 10 (M10K)
Ref Sequence ENSEMBL: ENSMUSP00000037712 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039164]
Predicted Effect possibly damaging
Transcript: ENSMUST00000039164
AA Change: M10K

PolyPhen 2 Score 0.703 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000037712
Gene: ENSMUSG00000036832
AA Change: M10K

DomainStartEndE-ValueType
Pfam:7tm_1 47 293 2.4e-37 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the G protein-coupled receptor family, as well as the EDG family of proteins. This protein functions as a cellular receptor for lysophosphatidic acid and mediates lysophosphatidic acid-evoked calcium mobilization. This receptor couples predominantly to G(q/11) alpha proteins. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null females produce smaller litter sizes and exhibit delayed implantation and altered embryo spacing that leads to delayed development of embryos and hypertrophic placentas that were shared by multiple embryos. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahnak T A 19: 9,012,963 probably benign Het
Apc A T 18: 34,316,455 I2101F probably damaging Het
Bpifa3 G A 2: 154,133,713 V68I possibly damaging Het
Csmd1 T A 8: 16,211,850 I878F probably damaging Het
Cyp2c67 A T 19: 39,617,435 M339K probably damaging Het
Dock3 A G 9: 106,931,962 Y1321H probably damaging Het
Dsc1 G T 18: 20,097,299 D316E probably benign Het
Eno3 C T 11: 70,661,575 T351M possibly damaging Het
Erbb2 T A 11: 98,427,399 F487Y probably damaging Het
Exosc10 T C 4: 148,573,353 L652P probably benign Het
Glmn A T 5: 107,557,340 M470K probably damaging Het
Gm15446 T A 5: 109,943,036 C385S probably damaging Het
Gm597 G A 1: 28,778,699 A84V probably benign Het
Hspa8 A G 9: 40,804,975 E581G probably damaging Het
Igfn1 T C 1: 135,970,467 D787G probably benign Het
Igkv12-44 T C 6: 69,814,854 T42A possibly damaging Het
Itsn2 T C 12: 4,629,939 probably benign Het
Jade2 T C 11: 51,835,633 E84G probably damaging Het
Lpin2 A G 17: 71,243,930 D695G probably damaging Het
Mosmo T A 7: 120,726,195 L7H probably damaging Het
Ms4a8a C T 19: 11,081,072 A9T unknown Het
Myb T C 10: 21,154,754 D48G probably damaging Het
Neurod6 T C 6: 55,678,791 Y287C probably damaging Het
Olfr878 A G 9: 37,918,659 M1V probably null Het
Olfr96 A G 17: 37,225,568 T148A probably benign Het
Olr1 T A 6: 129,499,984 D106V probably damaging Het
Peg10 C CCCATCAGGA 6: 4,756,351 probably benign Het
Plch1 C T 3: 63,702,023 R912H probably damaging Het
Ppfia3 T C 7: 45,354,703 Y505C probably damaging Het
Sdk2 T A 11: 113,854,364 I702F probably damaging Het
Slc16a11 T C 11: 70,215,436 F119L probably benign Het
Slc2a10 A C 2: 165,517,703 T496P probably damaging Het
Slc7a2 T C 8: 40,900,169 Y181H probably damaging Het
Stab2 G T 10: 86,907,190 P1185Q probably damaging Het
Tcf7l2 T A 19: 55,919,014 S335R probably damaging Het
Ttc41 G A 10: 86,759,088 probably null Het
Vmn2r32 A T 7: 7,464,093 I812N probably damaging Het
Wdr24 C T 17: 25,824,605 H134Y probably benign Het
Other mutations in Lpar3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02444:Lpar3 APN 3 146241194 missense probably damaging 1.00
R0656:Lpar3 UTSW 3 146240671 missense possibly damaging 0.54
R0893:Lpar3 UTSW 3 146240593 missense possibly damaging 0.82
R1809:Lpar3 UTSW 3 146240548 splice site probably benign
R4937:Lpar3 UTSW 3 146284751 missense probably damaging 0.98
R6587:Lpar3 UTSW 3 146241163 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAGGCCAGGAGTGAACTTACTG -3'
(R):5'- AGGAACACGTAAGCGATTCC -3'

Sequencing Primer
(F):5'- TGAACTTACTGAAAGGAGTCACC -3'
(R):5'- TCCGCAGCAGCTAAGTTAG -3'
Posted On2017-08-16