Incidental Mutation 'R6116:Itsn2'
ID485133
Institutional Source Beutler Lab
Gene Symbol Itsn2
Ensembl Gene ENSMUSG00000020640
Gene Nameintersectin 2
SynonymsSh3d1B, Eh domain, SH3 domain regulator of endocytosis 2, Ese2, Sh3p18
MMRRC Submission 044265-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6116 (G1)
Quality Score225.009
Status Not validated
Chromosome12
Chromosomal Location4592638-4713962 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to C at 4629939 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000151663 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062580] [ENSMUST00000218402] [ENSMUST00000219007] [ENSMUST00000220311]
Predicted Effect unknown
Transcript: ENSMUST00000062580
AA Change: S211P
SMART Domains Protein: ENSMUSP00000052758
Gene: ENSMUSG00000020640
AA Change: S211P

DomainStartEndE-ValueType
EH 15 109 8.44e-41 SMART
EFh 58 86 7.18e-3 SMART
low complexity region 156 169 N/A INTRINSIC
low complexity region 215 231 N/A INTRINSIC
EH 238 333 4.06e-43 SMART
EFh 282 310 6.16e-2 SMART
coiled coil region 366 462 N/A INTRINSIC
coiled coil region 516 556 N/A INTRINSIC
coiled coil region 580 715 N/A INTRINSIC
SH3 721 778 2.65e-21 SMART
low complexity region 791 811 N/A INTRINSIC
SH3 855 909 8.83e-18 SMART
SH3 945 999 9.1e-20 SMART
SH3 1017 1077 1.55e-13 SMART
SH3 1091 1146 7.22e-23 SMART
RhoGEF 1174 1355 1.93e-56 SMART
PH 1396 1507 1.16e-9 SMART
C2 1531 1628 3.96e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000217672
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217882
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217942
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217981
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218072
Predicted Effect probably benign
Transcript: ENSMUST00000218402
Predicted Effect unknown
Transcript: ENSMUST00000219007
AA Change: S211P
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219832
Predicted Effect unknown
Transcript: ENSMUST00000220311
AA Change: S211P
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cytoplasmic protein which contains SH3 domains. This protein is a member of a family of proteins involved in clathrin-mediated endocytosis. Intersectin 2 is thought to regulate the formation of clathrin-coated vesicles and also may function in the induction of T cell antigen receptor (TCR) endocytosis. [provided by RefSeq, Jan 2017]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal brain morphology and function and behavior. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahnak T A 19: 9,012,963 probably benign Het
Apc A T 18: 34,316,455 I2101F probably damaging Het
Bpifa3 G A 2: 154,133,713 V68I possibly damaging Het
Csmd1 T A 8: 16,211,850 I878F probably damaging Het
Cyp2c67 A T 19: 39,617,435 M339K probably damaging Het
Dock3 A G 9: 106,931,962 Y1321H probably damaging Het
Dsc1 G T 18: 20,097,299 D316E probably benign Het
Eno3 C T 11: 70,661,575 T351M possibly damaging Het
Erbb2 T A 11: 98,427,399 F487Y probably damaging Het
Exosc10 T C 4: 148,573,353 L652P probably benign Het
Glmn A T 5: 107,557,340 M470K probably damaging Het
Gm15446 T A 5: 109,943,036 C385S probably damaging Het
Gm597 G A 1: 28,778,699 A84V probably benign Het
Hspa8 A G 9: 40,804,975 E581G probably damaging Het
Igfn1 T C 1: 135,970,467 D787G probably benign Het
Igkv12-44 T C 6: 69,814,854 T42A possibly damaging Het
Jade2 T C 11: 51,835,633 E84G probably damaging Het
Lpar3 T A 3: 146,240,597 M10K possibly damaging Het
Lpin2 A G 17: 71,243,930 D695G probably damaging Het
Mosmo T A 7: 120,726,195 L7H probably damaging Het
Ms4a8a C T 19: 11,081,072 A9T unknown Het
Myb T C 10: 21,154,754 D48G probably damaging Het
Neurod6 T C 6: 55,678,791 Y287C probably damaging Het
Olfr878 A G 9: 37,918,659 M1V probably null Het
Olfr96 A G 17: 37,225,568 T148A probably benign Het
Olr1 T A 6: 129,499,984 D106V probably damaging Het
Peg10 C CCCATCAGGA 6: 4,756,351 probably benign Het
Plch1 C T 3: 63,702,023 R912H probably damaging Het
Ppfia3 T C 7: 45,354,703 Y505C probably damaging Het
Sdk2 T A 11: 113,854,364 I702F probably damaging Het
Slc16a11 T C 11: 70,215,436 F119L probably benign Het
Slc2a10 A C 2: 165,517,703 T496P probably damaging Het
Slc7a2 T C 8: 40,900,169 Y181H probably damaging Het
Stab2 G T 10: 86,907,190 P1185Q probably damaging Het
Tcf7l2 T A 19: 55,919,014 S335R probably damaging Het
Ttc41 G A 10: 86,759,088 probably null Het
Vmn2r32 A T 7: 7,464,093 I812N probably damaging Het
Wdr24 C T 17: 25,824,605 H134Y probably benign Het
Other mutations in Itsn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00341:Itsn2 APN 12 4658027 missense possibly damaging 0.95
IGL00647:Itsn2 APN 12 4613311 splice site probably benign
IGL00933:Itsn2 APN 12 4707540 missense probably damaging 1.00
IGL01686:Itsn2 APN 12 4636693 splice site probably benign
IGL01873:Itsn2 APN 12 4632366 splice site probably benign
IGL02200:Itsn2 APN 12 4636632 missense probably damaging 0.98
IGL02280:Itsn2 APN 12 4708961 missense possibly damaging 0.89
IGL02388:Itsn2 APN 12 4629557 missense possibly damaging 0.91
IGL02938:Itsn2 APN 12 4697216 missense probably damaging 0.98
inversus UTSW 12 4639670 nonsense probably null
liberator UTSW 12 4666176 nonsense probably null
rolled UTSW 12 4634792 nonsense probably null
stratofortress UTSW 12 4624927 missense probably damaging 1.00
R0101:Itsn2 UTSW 12 4633058 unclassified probably benign
R0268:Itsn2 UTSW 12 4700333 missense probably benign 0.12
R0584:Itsn2 UTSW 12 4697180 missense probably benign
R0604:Itsn2 UTSW 12 4658189 missense probably benign 0.01
R0639:Itsn2 UTSW 12 4712556 missense probably damaging 0.99
R0738:Itsn2 UTSW 12 4635681 missense probably benign 0.17
R1132:Itsn2 UTSW 12 4658464 missense probably damaging 1.00
R1163:Itsn2 UTSW 12 4712009 missense probably benign 0.30
R1169:Itsn2 UTSW 12 4639694 missense probably damaging 1.00
R1258:Itsn2 UTSW 12 4673464 missense probably damaging 1.00
R1297:Itsn2 UTSW 12 4700378 missense probably damaging 1.00
R1423:Itsn2 UTSW 12 4673572 missense probably damaging 0.97
R1572:Itsn2 UTSW 12 4650044 missense probably benign 0.03
R1601:Itsn2 UTSW 12 4658452 missense probably benign 0.01
R1628:Itsn2 UTSW 12 4629652 missense probably benign
R1650:Itsn2 UTSW 12 4637767 missense probably damaging 0.97
R1752:Itsn2 UTSW 12 4711950 splice site probably null
R1758:Itsn2 UTSW 12 4658160 missense possibly damaging 0.83
R1942:Itsn2 UTSW 12 4639670 nonsense probably null
R1976:Itsn2 UTSW 12 4672733 splice site probably benign
R2000:Itsn2 UTSW 12 4666176 nonsense probably null
R2060:Itsn2 UTSW 12 4627879 missense probably damaging 1.00
R2119:Itsn2 UTSW 12 4707025 missense probably benign 0.32
R2168:Itsn2 UTSW 12 4633044 unclassified probably benign
R2394:Itsn2 UTSW 12 4707005 missense possibly damaging 0.86
R2860:Itsn2 UTSW 12 4700315 splice site probably benign
R2861:Itsn2 UTSW 12 4700315 splice site probably benign
R2900:Itsn2 UTSW 12 4630713 unclassified probably benign
R2991:Itsn2 UTSW 12 4658474 missense probably benign 0.01
R3087:Itsn2 UTSW 12 4666303 missense probably damaging 1.00
R3881:Itsn2 UTSW 12 4634546 unclassified probably benign
R4022:Itsn2 UTSW 12 4624927 missense probably damaging 1.00
R4332:Itsn2 UTSW 12 4712611 missense possibly damaging 0.72
R4657:Itsn2 UTSW 12 4713197 makesense probably null
R4727:Itsn2 UTSW 12 4707660 missense probably damaging 0.99
R4745:Itsn2 UTSW 12 4661944 missense probably damaging 1.00
R4770:Itsn2 UTSW 12 4627892 missense probably damaging 1.00
R4905:Itsn2 UTSW 12 4634583 unclassified probably benign
R5269:Itsn2 UTSW 12 4633553 unclassified probably benign
R5314:Itsn2 UTSW 12 4627960 missense probably benign 0.09
R5345:Itsn2 UTSW 12 4672783 missense probably damaging 1.00
R5399:Itsn2 UTSW 12 4653535 missense probably benign 0.22
R5566:Itsn2 UTSW 12 4626554 missense probably damaging 1.00
R5725:Itsn2 UTSW 12 4630767 unclassified probably benign
R5773:Itsn2 UTSW 12 4707089 missense probably damaging 1.00
R6254:Itsn2 UTSW 12 4624982 splice site probably null
R6325:Itsn2 UTSW 12 4706351 missense probably damaging 1.00
R6361:Itsn2 UTSW 12 4629655 missense probably benign 0.18
R6456:Itsn2 UTSW 12 4629923 unclassified probably benign
R6494:Itsn2 UTSW 12 4634792 nonsense probably null
R6854:Itsn2 UTSW 12 4652382 missense probably benign 0.37
R6941:Itsn2 UTSW 12 4629641 missense probably benign 0.05
R6961:Itsn2 UTSW 12 4673420 nonsense probably null
R7326:Itsn2 UTSW 12 4632985 missense unknown
R7387:Itsn2 UTSW 12 4639781 missense probably damaging 1.00
R7465:Itsn2 UTSW 12 4706983 nonsense probably null
R7471:Itsn2 UTSW 12 4708198 missense probably benign 0.43
Z1088:Itsn2 UTSW 12 4712472 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTGCCAGTCTCATTCAGCC -3'
(R):5'- CTGGCCAGGGAATTTATAGATGAC -3'

Sequencing Primer
(F):5'- GTGTCTAATAAGTCAAGATGTGAGG -3'
(R):5'- GTCTAGTCTACAGAGCAAGTTCTAGG -3'
Posted On2017-08-16