Incidental Mutation 'R6166:Sowahc'
ID490149
Institutional Source Beutler Lab
Gene Symbol Sowahc
Ensembl Gene ENSMUSG00000098188
Gene Namesosondowah ankyrin repeat domain family member C
SynonymsC820004L04Rik, Ankrd57
MMRRC Submission 044312-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.444) question?
Stock #R6166 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location59221953-59226434 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 59222360 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 106 (D106G)
Ref Sequence ENSEMBL: ENSMUSP00000138351 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000165971] [ENSMUST00000182161] [ENSMUST00000220156]
Predicted Effect probably benign
Transcript: ENSMUST00000165971
SMART Domains Protein: ENSMUSP00000129023
Gene: ENSMUSG00000019917

DomainStartEndE-ValueType
Pfam:Septin 36 307 1.1e-100 PFAM
Pfam:MMR_HSR1 41 182 2.2e-7 PFAM
low complexity region 374 389 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000182161
AA Change: D106G

PolyPhen 2 Score 0.439 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000138351
Gene: ENSMUSG00000098188
AA Change: D106G

DomainStartEndE-ValueType
low complexity region 173 187 N/A INTRINSIC
low complexity region 213 250 N/A INTRINSIC
ANK 288 323 1.54e-1 SMART
ANK 327 357 3.57e-6 SMART
low complexity region 434 452 N/A INTRINSIC
low complexity region 481 492 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000220156
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.7%
Validation Efficiency 97% (57/59)
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik A G 15: 8,186,560 H478R probably benign Het
Acot2 A T 12: 83,992,604 N296Y probably damaging Het
Ago2 T A 15: 73,124,240 I347L probably benign Het
Aldh1l2 C T 10: 83,493,424 probably null Het
Ap1ar A G 3: 127,812,528 probably null Het
Arap3 T C 18: 37,974,370 T1365A probably damaging Het
Arhgef17 A T 7: 100,876,492 H1966Q probably damaging Het
Arpp21 T C 9: 112,119,198 T668A probably benign Het
Atg13 G T 2: 91,676,391 Q479K probably damaging Het
BC049730 A T 7: 24,714,219 Q220L probably benign Het
Bmp8a T C 4: 123,324,678 T183A probably benign Het
Camta2 G C 11: 70,674,261 probably null Het
Ccdc40 T C 11: 119,232,001 S210P probably benign Het
Cnn2 A G 10: 79,988,727 E17G possibly damaging Het
Cnot6l T C 5: 96,079,940 D478G possibly damaging Het
Csf2rb A G 15: 78,344,566 Y369C probably damaging Het
Dll4 A G 2: 119,334,626 probably null Het
Efcab6 A G 15: 83,896,115 V1039A probably benign Het
Fam117a T C 11: 95,380,781 M393T possibly damaging Het
Fancd2 T A 6: 113,555,251 N508K possibly damaging Het
Fat1 T C 8: 44,952,485 S758P probably damaging Het
Fgf20 T C 8: 40,279,840 K186E probably damaging Het
Filip1 T C 9: 79,819,454 K628E probably damaging Het
Fsip2 G T 2: 82,980,727 K2463N probably benign Het
Gm15446 T A 5: 109,942,780 Y299* probably null Het
Gm16432 A G 1: 178,103,837 T441A unknown Het
Gm7363 A T 7: 3,983,785 noncoding transcript Het
Gpx5 A T 13: 21,289,265 F104I probably damaging Het
Grip1 A T 10: 120,072,718 I618F probably damaging Het
Hmcn2 G A 2: 31,369,262 G1038D probably damaging Het
Lgals9 C T 11: 78,971,358 A134T probably benign Het
Lrba G A 3: 86,354,307 probably null Het
Naprt T C 15: 75,891,477 Q439R possibly damaging Het
Ndufs6 G A 13: 73,317,941 probably benign Het
Nodal C A 10: 61,424,558 S329R probably damaging Het
Olfm3 T A 3: 115,122,425 N315K probably damaging Het
Olfr420 A G 1: 174,159,093 T107A probably benign Het
Olfr730 C T 14: 50,186,768 V150I probably benign Het
Olfr803 A T 10: 129,691,279 I254K probably damaging Het
Plg T A 17: 12,398,114 V373E probably damaging Het
Prdm2 A C 4: 143,134,736 S661R probably damaging Het
Psg21 A T 7: 18,656,739 probably benign Het
Rhobtb2 T C 14: 69,798,178 D148G probably damaging Het
Rsf1 GCG GCGACGGCGACG 7: 97,579,907 probably benign Het
Scaf11 A T 15: 96,424,662 N116K probably damaging Het
Sf3a3 T C 4: 124,723,384 probably benign Homo
Slc38a9 T G 13: 112,695,267 Y184D possibly damaging Het
Srbd1 T C 17: 86,099,268 Y563C probably damaging Het
Src A G 2: 157,468,522 Y359C probably damaging Het
Tbc1d9b A G 11: 50,135,846 D47G probably damaging Het
Tctn3 T C 19: 40,597,479 K541E possibly damaging Het
Tgm7 A G 2: 121,099,058 V245A probably damaging Het
Thbs2 C T 17: 14,680,388 R519H probably damaging Het
Tm4sf19 T C 16: 32,407,863 S157P probably damaging Het
Trio C T 15: 27,818,071 S507N probably damaging Het
Trrap T A 5: 144,781,981 H152Q possibly damaging Het
Vmn2r56 A G 7: 12,694,020 L773P probably damaging Het
Vmn2r70 A G 7: 85,565,981 L115P probably benign Het
Wdr59 C T 8: 111,472,661 R631H probably damaging Het
Other mutations in Sowahc
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0744:Sowahc UTSW 10 59223491 unclassified probably benign
R0753:Sowahc UTSW 10 59223491 unclassified probably benign
R4747:Sowahc UTSW 10 59223161 missense probably benign 0.07
R5523:Sowahc UTSW 10 59222963 missense probably benign 0.01
R5650:Sowahc UTSW 10 59223491 unclassified probably benign
R5658:Sowahc UTSW 10 59223227 missense possibly damaging 0.46
R5838:Sowahc UTSW 10 59223190 missense possibly damaging 0.88
R5959:Sowahc UTSW 10 59223098 missense probably benign 0.23
R6365:Sowahc UTSW 10 59223527 missense probably damaging 1.00
R7203:Sowahc UTSW 10 59222278 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGCAACACTTCAGGGACGTC -3'
(R):5'- TTTAAGGTTCTCGCTGGACCC -3'

Sequencing Primer
(F):5'- ACGTCCTGGGTGGCCAG -3'
(R):5'- CTCGCTGGACCCGGGAC -3'
Posted On2017-10-10