Incidental Mutation 'R5395:Gli3'
ID500998
Institutional Source Beutler Lab
Gene Symbol Gli3
Ensembl Gene ENSMUSG00000021318
Gene NameGLI-Kruppel family member GLI3
Synonymsbrachyphalangy, Bph
MMRRC Submission 042967-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5395 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location15463235-15730026 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 15714950 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 550 (F550L)
Ref Sequence ENSEMBL: ENSMUSP00000115989 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110510] [ENSMUST00000130065]
Predicted Effect probably damaging
Transcript: ENSMUST00000110510
AA Change: F550L

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000106137
Gene: ENSMUSG00000021318
AA Change: F550L

DomainStartEndE-ValueType
low complexity region 120 136 N/A INTRINSIC
low complexity region 204 220 N/A INTRINSIC
low complexity region 324 341 N/A INTRINSIC
low complexity region 403 421 N/A INTRINSIC
ZnF_C2H2 480 505 1.53e-1 SMART
ZnF_C2H2 513 540 1.23e0 SMART
ZnF_C2H2 546 570 3.16e-3 SMART
ZnF_C2H2 576 601 4.17e-3 SMART
ZnF_C2H2 607 632 1.4e-4 SMART
low complexity region 703 726 N/A INTRINSIC
low complexity region 756 763 N/A INTRINSIC
low complexity region 849 880 N/A INTRINSIC
low complexity region 934 944 N/A INTRINSIC
low complexity region 1024 1038 N/A INTRINSIC
low complexity region 1081 1095 N/A INTRINSIC
low complexity region 1166 1175 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000130065
AA Change: F550L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000115989
Gene: ENSMUSG00000021318
AA Change: F550L

DomainStartEndE-ValueType
low complexity region 120 136 N/A INTRINSIC
low complexity region 204 220 N/A INTRINSIC
low complexity region 324 341 N/A INTRINSIC
low complexity region 403 421 N/A INTRINSIC
ZnF_C2H2 480 505 1.53e-1 SMART
ZnF_C2H2 513 540 1.23e0 SMART
ZnF_C2H2 546 570 3.16e-3 SMART
ZnF_C2H2 576 596 1.45e2 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which belongs to the C2H2-type zinc finger proteins subclass of the Gli family. They are characterized as DNA-binding transcription factors and are mediators of Sonic hedgehog (Shh) signaling. The protein encoded by this gene localizes in the cytoplasm and activates patched Drosophila homolog (PTCH) gene expression. It is also thought to play a role during embryogenesis. Mutations in this gene have been associated with several diseases, including Greig cephalopolysyndactyly syndrome, Pallister-Hall syndrome, preaxial polydactyly type IV, and postaxial polydactyly types A1 and B. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutants die perinatally with gross polydactyly, multiple craniofacial defects, and frequently, exencephaly. Heterozygotes exhibit enlarged interfrontal bone and extra preaxial digits. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 A G 3: 122,080,941 I268V probably benign Het
Actn1 T A 12: 80,170,703 I782F probably benign Het
Adamdec1 A C 14: 68,570,903 S333A probably benign Het
Agbl5 C A 5: 30,890,338 T58N probably damaging Het
Apoo-ps T A 13: 107,414,493 noncoding transcript Het
Arhgef10l T C 4: 140,570,290 N277S probably benign Het
Ascc2 A G 11: 4,659,273 E241G possibly damaging Het
Atp13a4 A T 16: 29,420,888 Y835* probably null Het
Atp13a4 A G 16: 29,456,604 V354A possibly damaging Het
Bcas3 T C 11: 85,825,249 S426P probably damaging Het
Birc3 T C 9: 7,861,174 R48G probably damaging Het
Cacna2d4 T C 6: 119,271,418 S397P possibly damaging Het
Ccng2 T C 5: 93,269,398 M91T possibly damaging Het
Clk3 G A 9: 57,753,339 T473M probably damaging Het
Cog2 T A 8: 124,545,221 H491Q probably benign Het
Cyp4f40 C T 17: 32,669,853 T202I probably benign Het
Dennd1a A T 2: 37,802,128 F181I probably damaging Het
Fcrl6 G T 1: 172,598,720 A170D possibly damaging Het
Fev T C 1: 74,882,664 probably null Het
Flnb A G 14: 7,883,881 N369S probably benign Het
Flt3 A G 5: 147,354,823 F606L probably damaging Het
Gdf9 T C 11: 53,433,797 V131A probably benign Het
Gdnf T A 15: 7,834,684 L192Q probably damaging Het
Gjc2 A T 11: 59,177,489 C56S possibly damaging Het
Gm1110 T C 9: 26,889,632 E422G probably benign Het
Gm14325 G A 2: 177,832,984 H102Y possibly damaging Het
Gnb2 A G 5: 137,528,526 S334P probably damaging Het
Icam2 A T 11: 106,382,473 probably null Het
Inca1 C T 11: 70,690,438 probably null Het
Itgb8 A C 12: 119,170,741 C530W probably damaging Het
Lrp1 T C 10: 127,595,297 D332G probably damaging Het
Ly75 A T 2: 60,365,111 N234K probably benign Het
Mcm5 G A 8: 75,123,026 S542N probably benign Het
Mcm9 A T 10: 53,538,692 N97K possibly damaging Het
Morc2a G A 11: 3,688,232 R986H possibly damaging Het
Neu2 T A 1: 87,596,675 probably null Het
Nfatc1 G A 18: 80,636,020 P718S possibly damaging Het
Nol6 G A 4: 41,118,392 probably benign Het
Olfr1406 A T 1: 173,183,680 Y251* probably null Het
Otogl T C 10: 107,817,138 N1118D probably benign Het
Pcdh15 T A 10: 74,185,287 I111K probably damaging Het
Phkb A G 8: 86,017,468 D582G probably damaging Het
Piwil2 G T 14: 70,395,397 N575K probably benign Het
Pou4f2 T A 8: 78,435,072 I301F probably damaging Het
Prkd1 T C 12: 50,391,432 N409S probably damaging Het
Ptpn21 T G 12: 98,715,117 K86T probably damaging Het
Raly T A 2: 154,864,007 probably null Het
Rangap1 A G 15: 81,706,446 F482L probably benign Het
Rapgef1 T A 2: 29,737,965 N1052K probably damaging Het
Rnf169 A T 7: 99,935,160 probably null Het
Sdr16c5 T C 4: 4,016,277 S50G probably benign Het
Sin3a G A 9: 57,105,673 R612H probably damaging Het
Six6 T A 12: 72,941,701 L216* probably null Het
Slc20a1 A T 2: 129,208,337 N472Y probably damaging Het
Slc35d1 C T 4: 103,211,375 probably null Het
Slc45a2 C T 15: 11,027,785 T480I probably damaging Het
Slc7a8 C A 14: 54,733,277 G306* probably null Het
Slc9a8 T A 2: 167,467,722 F335L probably damaging Het
Smyd1 T G 6: 71,219,390 K338T possibly damaging Het
Snd1 T A 6: 28,526,184 V187E probably damaging Het
Spag9 T G 11: 94,091,751 probably null Het
Tnfsf9 C A 17: 57,105,592 T54K probably benign Het
Trim24 T G 6: 37,957,744 V798G probably damaging Het
Tyr C A 7: 87,472,490 A365S probably damaging Het
Usp43 T A 11: 67,897,358 probably null Het
Vmn2r55 T C 7: 12,651,947 D702G probably damaging Het
Vmn2r72 A G 7: 85,750,897 S315P possibly damaging Het
Wdr64 T A 1: 175,755,598 F367I probably damaging Het
Zc3h7b G A 15: 81,772,501 R173K possibly damaging Het
Zfp493 T A 13: 67,783,846 C21* probably null Het
Zfp825 T C 13: 74,480,546 T284A possibly damaging Het
Zpbp2 T A 11: 98,558,213 V275D probably damaging Het
Other mutations in Gli3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00417:Gli3 APN 13 15644299 missense probably damaging 1.00
IGL00471:Gli3 APN 13 15723769 critical splice donor site probably null
IGL00484:Gli3 APN 13 15644392 missense possibly damaging 0.84
IGL00588:Gli3 APN 13 15644392 missense possibly damaging 0.84
IGL01161:Gli3 APN 13 15548398 critical splice acceptor site probably null
IGL01633:Gli3 APN 13 15648634 missense probably damaging 1.00
IGL01799:Gli3 APN 13 15726161 missense probably benign 0.00
IGL01861:Gli3 APN 13 15725325 missense probably damaging 1.00
IGL02063:Gli3 APN 13 15726372 missense possibly damaging 0.94
IGL02112:Gli3 APN 13 15662514 missense probably damaging 1.00
IGL02255:Gli3 APN 13 15648719 missense probably damaging 1.00
IGL02270:Gli3 APN 13 15726786 utr 3 prime probably benign
IGL02336:Gli3 APN 13 15720289 missense probably damaging 1.00
IGL02346:Gli3 APN 13 15723693 missense probably damaging 1.00
IGL02744:Gli3 APN 13 15613886 critical splice donor site probably null
IGL02877:Gli3 APN 13 15724742 missense probably damaging 1.00
IGL02975:Gli3 APN 13 15724568 missense probably damaging 1.00
IGL03018:Gli3 APN 13 15660132 missense probably damaging 1.00
IGL03378:Gli3 APN 13 15644420 missense probably damaging 1.00
IGL03406:Gli3 APN 13 15648581 missense probably damaging 1.00
FR4737:Gli3 UTSW 13 15644357 missense probably damaging 1.00
R0110:Gli3 UTSW 13 15724785 missense probably damaging 1.00
R0329:Gli3 UTSW 13 15723558 missense probably damaging 0.98
R0330:Gli3 UTSW 13 15723558 missense probably damaging 0.98
R0360:Gli3 UTSW 13 15724764 missense probably benign 0.32
R0364:Gli3 UTSW 13 15724764 missense probably benign 0.32
R0469:Gli3 UTSW 13 15724785 missense probably damaging 1.00
R0616:Gli3 UTSW 13 15662406 missense possibly damaging 0.75
R0639:Gli3 UTSW 13 15724715 missense probably damaging 1.00
R1072:Gli3 UTSW 13 15713605 missense probably damaging 1.00
R1257:Gli3 UTSW 13 15725996 nonsense probably null
R1270:Gli3 UTSW 13 15723744 missense probably benign 0.02
R1424:Gli3 UTSW 13 15726314 missense probably benign 0.00
R1481:Gli3 UTSW 13 15613850 missense probably damaging 0.99
R1596:Gli3 UTSW 13 15725471 missense possibly damaging 0.74
R1628:Gli3 UTSW 13 15726312 missense probably benign 0.00
R1721:Gli3 UTSW 13 15726297 missense probably benign 0.27
R1797:Gli3 UTSW 13 15713512 missense probably damaging 0.99
R1813:Gli3 UTSW 13 15648691 missense probably damaging 1.00
R1819:Gli3 UTSW 13 15725792 nonsense probably null
R1988:Gli3 UTSW 13 15726380 missense probably benign
R2132:Gli3 UTSW 13 15725549 missense possibly damaging 0.74
R2352:Gli3 UTSW 13 15662392 missense probably benign 0.02
R3085:Gli3 UTSW 13 15660941 missense probably damaging 1.00
R3177:Gli3 UTSW 13 15725982 missense probably benign 0.28
R3277:Gli3 UTSW 13 15725982 missense probably benign 0.28
R4162:Gli3 UTSW 13 15725115 missense possibly damaging 0.93
R4497:Gli3 UTSW 13 15723571 missense possibly damaging 0.74
R4526:Gli3 UTSW 13 15713631 missense probably damaging 1.00
R4979:Gli3 UTSW 13 15724464 missense possibly damaging 0.87
R5327:Gli3 UTSW 13 15548507 missense probably damaging 0.99
R5494:Gli3 UTSW 13 15725982 missense probably benign 0.28
R5609:Gli3 UTSW 13 15548453 missense possibly damaging 0.82
R5718:Gli3 UTSW 13 15478165 critical splice donor site probably null
R5810:Gli3 UTSW 13 15644309 missense probably damaging 0.99
R5896:Gli3 UTSW 13 15726180 missense probably benign 0.00
R5930:Gli3 UTSW 13 15548625 missense probably damaging 1.00
R5964:Gli3 UTSW 13 15726162 nonsense probably null
R5985:Gli3 UTSW 13 15723555 missense probably damaging 1.00
R6224:Gli3 UTSW 13 15725145 missense probably benign
R6278:Gli3 UTSW 13 15725113 missense possibly damaging 0.69
R6330:Gli3 UTSW 13 15724732 missense probably damaging 1.00
R6383:Gli3 UTSW 13 15723555 missense probably damaging 1.00
R6523:Gli3 UTSW 13 15713650 critical splice donor site probably null
R7072:Gli3 UTSW 13 15725695 missense possibly damaging 0.51
R7085:Gli3 UTSW 13 15715062 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTTCGGGAGTTTTACAGGCAC -3'
(R):5'- TGCCACATGGAAGCTTACC -3'

Sequencing Primer
(F):5'- AGGCACTGACAACGCTTTG -3'
(R):5'- CACATGGAAGCTTACCTCATTGG -3'
Posted On2017-12-01