Incidental Mutation 'R6323:Nsmf'
ID510185
Institutional Source Beutler Lab
Gene Symbol Nsmf
Ensembl Gene ENSMUSG00000006476
Gene NameNMDA receptor synaptonuclear signaling and neuronal migration factor
SynonymsJacob, Nelf
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.103) question?
Stock #R6323 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location25054355-25062881 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 25055051 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 42 (N42S)
Ref Sequence ENSEMBL: ENSMUSP00000141583 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006646] [ENSMUST00000045295] [ENSMUST00000074422] [ENSMUST00000100334] [ENSMUST00000102931] [ENSMUST00000114386] [ENSMUST00000114388] [ENSMUST00000116574] [ENSMUST00000132172] [ENSMUST00000137913] [ENSMUST00000140737] [ENSMUST00000144520] [ENSMUST00000152122] [ENSMUST00000155601]
Predicted Effect probably benign
Transcript: ENSMUST00000006646
AA Change: N42S

PolyPhen 2 Score 0.313 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000006646
Gene: ENSMUSG00000006476
AA Change: N42S

DomainStartEndE-ValueType
low complexity region 3 28 N/A INTRINSIC
low complexity region 281 292 N/A INTRINSIC
low complexity region 361 375 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000045295
SMART Domains Protein: ENSMUSP00000044078
Gene: ENSMUSG00000036833

DomainStartEndE-ValueType
transmembrane domain 36 58 N/A INTRINSIC
low complexity region 59 66 N/A INTRINSIC
cNMP 170 295 2.06e-12 SMART
low complexity region 439 444 N/A INTRINSIC
cNMP 481 600 1.16e-6 SMART
cNMP 603 716 1.55e-7 SMART
Pfam:Patatin 950 1116 3.2e-24 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000074422
AA Change: N42S

PolyPhen 2 Score 0.454 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000074022
Gene: ENSMUSG00000006476
AA Change: N42S

DomainStartEndE-ValueType
low complexity region 3 28 N/A INTRINSIC
low complexity region 258 269 N/A INTRINSIC
low complexity region 338 352 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000100334
AA Change: N42S

PolyPhen 2 Score 0.313 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000097908
Gene: ENSMUSG00000006476
AA Change: N42S

DomainStartEndE-ValueType
low complexity region 3 28 N/A INTRINSIC
low complexity region 283 294 N/A INTRINSIC
low complexity region 363 377 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000102931
AA Change: N42S

PolyPhen 2 Score 0.313 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000099995
Gene: ENSMUSG00000006476
AA Change: N42S

DomainStartEndE-ValueType
low complexity region 3 28 N/A INTRINSIC
low complexity region 260 271 N/A INTRINSIC
low complexity region 340 354 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000114386
AA Change: N42S

PolyPhen 2 Score 0.597 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000110028
Gene: ENSMUSG00000006476
AA Change: N42S

DomainStartEndE-ValueType
low complexity region 3 28 N/A INTRINSIC
low complexity region 310 324 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000114388
AA Change: N42S

PolyPhen 2 Score 0.597 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000110030
Gene: ENSMUSG00000006476
AA Change: N42S

DomainStartEndE-ValueType
low complexity region 3 28 N/A INTRINSIC
low complexity region 331 345 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000116574
AA Change: N42S

PolyPhen 2 Score 0.454 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000112273
Gene: ENSMUSG00000006476
AA Change: N42S

DomainStartEndE-ValueType
low complexity region 3 28 N/A INTRINSIC
low complexity region 260 271 N/A INTRINSIC
low complexity region 340 354 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128517
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132082
Predicted Effect probably benign
Transcript: ENSMUST00000132172
AA Change: N42S

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000116106
Gene: ENSMUSG00000006476
AA Change: N42S

DomainStartEndE-ValueType
low complexity region 3 28 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000134744
SMART Domains Protein: ENSMUSP00000120376
Gene: ENSMUSG00000006476

DomainStartEndE-ValueType
low complexity region 3 12 N/A INTRINSIC
low complexity region 113 127 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135328
Predicted Effect probably benign
Transcript: ENSMUST00000137913
SMART Domains Protein: ENSMUSP00000141577
Gene: ENSMUSG00000036833

DomainStartEndE-ValueType
transmembrane domain 10 32 N/A INTRINSIC
low complexity region 33 40 N/A INTRINSIC
Pfam:cNMP_binding 162 200 2.7e-5 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138536
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140733
Predicted Effect possibly damaging
Transcript: ENSMUST00000140737
AA Change: N42S

PolyPhen 2 Score 0.617 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000141410
Gene: ENSMUSG00000006476
AA Change: N42S

DomainStartEndE-ValueType
low complexity region 3 28 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141584
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141866
Predicted Effect possibly damaging
Transcript: ENSMUST00000144520
AA Change: N42S

PolyPhen 2 Score 0.934 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000141583
Gene: ENSMUSG00000006476
AA Change: N42S

DomainStartEndE-ValueType
low complexity region 3 28 N/A INTRINSIC
low complexity region 283 294 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000152122
AA Change: N42S

PolyPhen 2 Score 0.056 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000121580
Gene: ENSMUSG00000006476
AA Change: N42S

DomainStartEndE-ValueType
low complexity region 3 28 N/A INTRINSIC
Pfam:IQ 62 80 2.5e-4 PFAM
low complexity region 114 125 N/A INTRINSIC
low complexity region 194 208 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154359
Predicted Effect probably benign
Transcript: ENSMUST00000155601
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155909
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175104
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184681
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.2%
Validation Efficiency 98% (40/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is involved in guidance of olfactory axon projections and migration of luteinizing hormone-releasing hormone neurons. Defects in this gene are a cause of idiopathic hypogonadotropic hypogonadism (IHH). Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit delayed sexual maturation in female mice with decreased uterus and ovary weights, reduced male and female fertility, and reduced gonadotrophs in female mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik G A 10: 82,283,082 T4698I probably benign Het
4933409G03Rik A G 2: 68,606,224 T171A unknown Het
Akr1c6 A G 13: 4,447,018 K153R possibly damaging Het
Ano1 T A 7: 144,611,686 I601F possibly damaging Het
Arfgef2 A G 2: 166,834,484 Y8C probably damaging Het
Arhgef4 G A 1: 34,723,477 A605T unknown Het
Atp1a2 C G 1: 172,289,336 R238P probably damaging Het
Baz2a A G 10: 128,126,417 I1816V probably benign Het
Cadps2 T A 6: 23,263,578 T1294S probably benign Het
Casz1 T C 4: 148,941,704 S952P possibly damaging Het
Cdc20 T C 4: 118,435,564 N329S probably damaging Het
Ceacam1 A C 7: 25,474,651 L193R probably damaging Het
Celf5 A G 10: 81,469,503 S143P probably damaging Het
Cfap74 A G 4: 155,463,938 D1342G possibly damaging Het
Chd5 C A 4: 152,367,334 T701K probably damaging Het
Cpt1b C A 15: 89,419,063 M596I probably benign Het
Ctrb1 A G 8: 111,689,591 V21A probably benign Het
Diaph3 C T 14: 86,966,453 V579I probably benign Het
Dlc1 T C 8: 36,938,383 E84G possibly damaging Het
Dnajc14 A G 10: 128,807,490 E427G probably damaging Het
Galns T C 8: 122,598,651 D254G probably damaging Het
Gpn3 C T 5: 122,372,575 probably benign Het
Gstm1 A G 3: 108,017,747 V10A probably benign Het
Krt13 C A 11: 100,121,150 A116S probably damaging Het
Lars2 A T 9: 123,441,594 K584* probably null Het
Lrrc43 G T 5: 123,503,886 G600W probably damaging Het
Madd G T 2: 91,161,438 probably null Het
Mnat1 A G 12: 73,168,104 D65G probably damaging Het
Olfr1283 T C 2: 111,368,701 L23P possibly damaging Het
Olfr198 A G 16: 59,202,282 L48P probably damaging Het
Palld A T 8: 61,720,693 W311R probably damaging Het
Pax1 T A 2: 147,368,401 V352E probably damaging Het
Rnf2 T C 1: 151,473,216 K51R probably damaging Het
Rpl7l1 C A 17: 46,782,638 probably benign Het
Slc17a2 A G 13: 23,814,986 I121V probably benign Het
Slc1a6 G A 10: 78,812,887 G481S probably damaging Het
Trav6-1 T C 14: 52,638,791 V56A possibly damaging Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Vmn2r79 T A 7: 87,001,314 C103S probably benign Het
Wwp2 A T 8: 107,540,671 H305L probably damaging Het
Zfp593 A G 4: 134,244,913 V94A probably benign Het
Other mutations in Nsmf
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02877:Nsmf APN 2 25055956 missense possibly damaging 0.47
IGL02965:Nsmf APN 2 25061762 missense probably damaging 0.99
R0079:Nsmf UTSW 2 25059084 splice site probably benign
R0786:Nsmf UTSW 2 25060510 missense probably damaging 1.00
R1553:Nsmf UTSW 2 25060259 missense probably damaging 1.00
R4091:Nsmf UTSW 2 25060859 missense probably damaging 1.00
R4750:Nsmf UTSW 2 25055026 missense probably damaging 1.00
R5032:Nsmf UTSW 2 25055061 critical splice donor site probably null
R5091:Nsmf UTSW 2 25060452 intron probably benign
R5245:Nsmf UTSW 2 25056107 missense probably damaging 1.00
R5687:Nsmf UTSW 2 25056067 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTCATGTTGATGTGGAAGGCC -3'
(R):5'- CTGTTGCCATGCCAACAAC -3'

Sequencing Primer
(F):5'- ATGTGGAAGGCCTGGGTG -3'
(R):5'- AGCTCCTCCTAGGGTTCTGG -3'
Posted On2018-04-02