Mutagenetix > Incidental Mutation

Incidental Mutation 'R6323:Nsmf'

510185

Institutional Source

Beutler Lab

Gene Symbol

Nsmf

Ensembl Gene

ENSMUSG00000006476

Gene Name

NMDA receptor synaptonuclear signaling and neuronal migration factor

Synonyms

Nelf, Jacob

MMRRC Submission

044477-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6323 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

24944370-24952893 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 24945063 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Serine at position 42 (N42S)

Ref Sequence

ENSEMBL: ENSMUSP00000141583 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000006646] [ENSMUST00000045295] [ENSMUST00000074422] [ENSMUST00000100334] [ENSMUST00000102931] [ENSMUST00000114386] [ENSMUST00000114388] [ENSMUST00000116574] [ENSMUST00000132172] [ENSMUST00000140737] [ENSMUST00000144520] [ENSMUST00000152122] [ENSMUST00000137913] [ENSMUST00000155601]

AlphaFold

Q99NF2

Predicted Effect

probably benign
Transcript: ENSMUST00000006646
AA Change: N42S

PolyPhen 2 Score 0.313 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000006646
Gene: ENSMUSG00000006476
AA Change: N42S

Domain	Start	End	E-Value	Type
low complexity region	3	28	N/A	INTRINSIC
low complexity region	281	292	N/A	INTRINSIC
low complexity region	361	375	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000045295

SMART Domains

Protein: ENSMUSP00000044078
Gene: ENSMUSG00000036833

Domain	Start	End	E-Value	Type
transmembrane domain	36	58	N/A	INTRINSIC
low complexity region	59	66	N/A	INTRINSIC
cNMP	170	295	2.06e-12	SMART
low complexity region	439	444	N/A	INTRINSIC
cNMP	481	600	1.16e-6	SMART
cNMP	603	716	1.55e-7	SMART
Pfam:Patatin	950	1116	3.2e-24	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000074422
AA Change: N42S

PolyPhen 2 Score 0.454 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000074022
Gene: ENSMUSG00000006476
AA Change: N42S

Domain	Start	End	E-Value	Type
low complexity region	3	28	N/A	INTRINSIC
low complexity region	258	269	N/A	INTRINSIC
low complexity region	338	352	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000100334
AA Change: N42S

PolyPhen 2 Score 0.313 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000097908
Gene: ENSMUSG00000006476
AA Change: N42S

Domain	Start	End	E-Value	Type
low complexity region	3	28	N/A	INTRINSIC
low complexity region	283	294	N/A	INTRINSIC
low complexity region	363	377	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000102931
AA Change: N42S

PolyPhen 2 Score 0.313 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000099995
Gene: ENSMUSG00000006476
AA Change: N42S

Domain	Start	End	E-Value	Type
low complexity region	3	28	N/A	INTRINSIC
low complexity region	260	271	N/A	INTRINSIC
low complexity region	340	354	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000114386
AA Change: N42S

PolyPhen 2 Score 0.597 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000110028
Gene: ENSMUSG00000006476
AA Change: N42S

Domain	Start	End	E-Value	Type
low complexity region	3	28	N/A	INTRINSIC
low complexity region	310	324	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000114388
AA Change: N42S

PolyPhen 2 Score 0.597 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000110030
Gene: ENSMUSG00000006476
AA Change: N42S

Domain	Start	End	E-Value	Type
low complexity region	3	28	N/A	INTRINSIC
low complexity region	331	345	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000116574
AA Change: N42S

PolyPhen 2 Score 0.454 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000112273
Gene: ENSMUSG00000006476
AA Change: N42S

Domain	Start	End	E-Value	Type
low complexity region	3	28	N/A	INTRINSIC
low complexity region	260	271	N/A	INTRINSIC
low complexity region	340	354	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000132172
AA Change: N42S

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)

SMART Domains

Protein: ENSMUSP00000116106
Gene: ENSMUSG00000006476
AA Change: N42S

Domain	Start	End	E-Value	Type
low complexity region	3	28	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000140737
AA Change: N42S

PolyPhen 2 Score 0.617 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000141410
Gene: ENSMUSG00000006476
AA Change: N42S

Domain	Start	End	E-Value	Type
low complexity region	3	28	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000144520
AA Change: N42S

PolyPhen 2 Score 0.934 (Sensitivity: 0.80; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000141583
Gene: ENSMUSG00000006476
AA Change: N42S

Domain	Start	End	E-Value	Type
low complexity region	3	28	N/A	INTRINSIC
low complexity region	283	294	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000152122
AA Change: N42S

PolyPhen 2 Score 0.056 (Sensitivity: 0.94; Specificity: 0.84)

SMART Domains

Protein: ENSMUSP00000121580
Gene: ENSMUSG00000006476
AA Change: N42S

Domain	Start	End	E-Value	Type
low complexity region	3	28	N/A	INTRINSIC
Pfam:IQ	62	80	2.5e-4	PFAM
low complexity region	114	125	N/A	INTRINSIC
low complexity region	194	208	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000141866

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000135328

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000140733

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000138536

Predicted Effect

probably benign
Transcript: ENSMUST00000137913

SMART Domains

Protein: ENSMUSP00000141577
Gene: ENSMUSG00000036833

Domain	Start	End	E-Value	Type
transmembrane domain	10	32	N/A	INTRINSIC
low complexity region	33	40	N/A	INTRINSIC
Pfam:cNMP_binding	162	200	2.7e-5	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000132082

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000128517

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000141584

Predicted Effect

probably benign
Transcript: ENSMUST00000134744

SMART Domains

Protein: ENSMUSP00000120376
Gene: ENSMUSG00000006476

Domain	Start	End	E-Value	Type
low complexity region	3	12	N/A	INTRINSIC
low complexity region	113	127	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000155909

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000154359

Predicted Effect

probably benign
Transcript: ENSMUST00000155601

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000175104

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000184681

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.4%
20x: 98.2%

Validation Efficiency

98% (40/41)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is involved in guidance of olfactory axon projections and migration of luteinizing hormone-releasing hormone neurons. Defects in this gene are a cause of idiopathic hypogonadotropic hypogonadism (IHH). Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit delayed sexual maturation in female mice with decreased uterus and ovary weights, reduced male and female fertility, and reduced gonadotrophs in female mice. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 41 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4933409G03Rik	A	G	2: 68,436,568 (GRCm39)	T171A	unknown	Het
Akr1c6	A	G	13: 4,497,017 (GRCm39)	K153R	possibly damaging	Het
Ano1	T	A	7: 144,165,423 (GRCm39)	I601F	possibly damaging	Het
Arfgef2	A	G	2: 166,676,404 (GRCm39)	Y8C	probably damaging	Het
Arhgef4	G	A	1: 34,762,558 (GRCm39)	A605T	unknown	Het
Atp1a2	C	G	1: 172,116,903 (GRCm39)	R238P	probably damaging	Het
Baz2a	A	G	10: 127,962,286 (GRCm39)	I1816V	probably benign	Het
Cadps2	T	A	6: 23,263,577 (GRCm39)	T1294S	probably benign	Het
Casz1	T	C	4: 149,026,161 (GRCm39)	S952P	possibly damaging	Het
Cdc20	T	C	4: 118,292,761 (GRCm39)	N329S	probably damaging	Het
Ceacam1	A	C	7: 25,174,076 (GRCm39)	L193R	probably damaging	Het
Celf5	A	G	10: 81,305,337 (GRCm39)	S143P	probably damaging	Het
Cfap74	A	G	4: 155,548,395 (GRCm39)	D1342G	possibly damaging	Het
Chd5	C	A	4: 152,451,791 (GRCm39)	T701K	probably damaging	Het
Cpt1b	C	A	15: 89,303,266 (GRCm39)	M596I	probably benign	Het
Ctrb1	A	G	8: 112,416,223 (GRCm39)	V21A	probably benign	Het
Diaph3	C	T	14: 87,203,889 (GRCm39)	V579I	probably benign	Het
Dlc1	T	C	8: 37,405,537 (GRCm39)	E84G	possibly damaging	Het
Dnajc14	A	G	10: 128,643,359 (GRCm39)	E427G	probably damaging	Het
Galns	T	C	8: 123,325,390 (GRCm39)	D254G	probably damaging	Het
Gpn3	C	T	5: 122,510,638 (GRCm39)		probably benign	Het
Gstm1	A	G	3: 107,925,063 (GRCm39)	V10A	probably benign	Het
Krt13	C	A	11: 100,011,976 (GRCm39)	A116S	probably damaging	Het
Lars2	A	T	9: 123,270,659 (GRCm39)	K584*	probably null	Het
Lrrc43	G	T	5: 123,641,949 (GRCm39)	G600W	probably damaging	Het
Madd	G	T	2: 90,991,783 (GRCm39)		probably null	Het
Mnat1	A	G	12: 73,214,878 (GRCm39)	D65G	probably damaging	Het
Or4k77	T	C	2: 111,199,046 (GRCm39)	L23P	possibly damaging	Het
Or5ac16	A	G	16: 59,022,645 (GRCm39)	L48P	probably damaging	Het
Palld	A	T	8: 62,173,727 (GRCm39)	W311R	probably damaging	Het
Pax1	T	A	2: 147,210,321 (GRCm39)	V352E	probably damaging	Het
Rnf2	T	C	1: 151,348,967 (GRCm39)	K51R	probably damaging	Het
Rpl7l1	C	A	17: 47,093,564 (GRCm39)		probably benign	Het
Slc1a6	G	A	10: 78,648,721 (GRCm39)	G481S	probably damaging	Het
Slc34a1	A	G	13: 23,998,969 (GRCm39)	I121V	probably benign	Het
Spata31h1	G	A	10: 82,118,916 (GRCm39)	T4698I	probably benign	Het
Trav6-1	T	C	14: 52,876,248 (GRCm39)	V56A	possibly damaging	Het
Vmn2r111	T	C	17: 22,778,032 (GRCm39)	N549S	possibly damaging	Het
Vmn2r79	T	A	7: 86,650,522 (GRCm39)	C103S	probably benign	Het
Wwp2	A	T	8: 108,267,303 (GRCm39)	H305L	probably damaging	Het
Zfp593	A	G	4: 133,972,224 (GRCm39)	V94A	probably benign	Het

Other mutations in Nsmf

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02877:Nsmf	APN	2	24,945,968 (GRCm39)	missense	possibly damaging	0.47
IGL02965:Nsmf	APN	2	24,951,774 (GRCm39)	missense	probably damaging	0.99
R0079:Nsmf	UTSW	2	24,949,096 (GRCm39)	splice site	probably benign
R0786:Nsmf	UTSW	2	24,950,522 (GRCm39)	missense	probably damaging	1.00
R1553:Nsmf	UTSW	2	24,950,271 (GRCm39)	missense	probably damaging	1.00
R4091:Nsmf	UTSW	2	24,950,871 (GRCm39)	missense	probably damaging	1.00
R4750:Nsmf	UTSW	2	24,945,038 (GRCm39)	missense	probably damaging	1.00
R5032:Nsmf	UTSW	2	24,945,073 (GRCm39)	critical splice donor site	probably null
R5091:Nsmf	UTSW	2	24,950,464 (GRCm39)	intron	probably benign
R5245:Nsmf	UTSW	2	24,946,119 (GRCm39)	missense	probably damaging	1.00
R5687:Nsmf	UTSW	2	24,946,079 (GRCm39)	missense	probably damaging	1.00
R9063:Nsmf	UTSW	2	24,952,622 (GRCm39)	missense	probably benign	0.03
R9710:Nsmf	UTSW	2	24,949,077 (GRCm39)	missense	probably null	0.00

Predicted Primers

PCR Primer
(F):5'- TCTCATGTTGATGTGGAAGGCC -3'
(R):5'- CTGTTGCCATGCCAACAAC -3'

Sequencing Primer
(F):5'- ATGTGGAAGGCCTGGGTG -3'
(R):5'- AGCTCCTCCTAGGGTTCTGG -3'

Posted On

2018-04-02