Incidental Mutation 'R6480:Slc25a24'
ID517021
Institutional Source Beutler Lab
Gene Symbol Slc25a24
Ensembl Gene ENSMUSG00000040322
Gene Namesolute carrier family 25 (mitochondrial carrier, phosphate carrier), member 24
Synonyms2610016M12Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6480 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location109123149-109168457 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 109136301 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Isoleucine at position 91 (M91I)
Ref Sequence ENSEMBL: ENSMUSP00000143109 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029477] [ENSMUST00000140786]
Predicted Effect probably benign
Transcript: ENSMUST00000029477
AA Change: M91I

PolyPhen 2 Score 0.025 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000029477
Gene: ENSMUSG00000040322
AA Change: M91I

DomainStartEndE-ValueType
EFh 23 51 3.08e-2 SMART
EFh 59 87 1.32e-1 SMART
EFh 90 118 1.65e-2 SMART
Blast:EFh 126 154 7e-9 BLAST
Pfam:Mito_carr 190 281 2.1e-27 PFAM
Pfam:Mito_carr 282 374 8.1e-27 PFAM
Pfam:Mito_carr 380 473 4.8e-22 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000140786
AA Change: M91I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000143109
Gene: ENSMUSG00000040322
AA Change: M91I

DomainStartEndE-ValueType
EFh 23 51 1.5e-4 SMART
EFh 59 87 6.3e-4 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.4%
Validation Efficiency 98% (57/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a carrier protein that transports ATP-Mg exchanging it for phosphate. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2012]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arl8b T A 6: 108,815,049 N90K possibly damaging Het
Art3 T C 5: 92,392,817 F140L probably damaging Het
Ascc3 T A 10: 50,710,953 M967K probably damaging Het
Ccne1 G A 7: 38,106,854 probably benign Het
Cdc14b T C 13: 64,225,650 probably null Het
Ceacam2 T A 7: 25,519,989 E282V probably damaging Het
Clk4 T A 11: 51,270,546 C86* probably null Het
Cul2 A C 18: 3,417,561 K115T possibly damaging Het
Dhx29 A T 13: 112,953,788 K800* probably null Het
Dlec1 T C 9: 119,147,690 F1741S probably benign Het
Dnah12 A G 14: 26,872,455 T3455A probably damaging Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Drd4 A T 7: 141,294,793 I366F possibly damaging Het
Fam169b T A 7: 68,353,718 Y273* probably null Het
Fbn1 T A 2: 125,335,418 Y1833F probably benign Het
Fsip2 A G 2: 82,990,086 T5388A possibly damaging Het
Gjb6 T C 14: 57,124,442 I121V probably benign Het
Glg1 T C 8: 111,197,706 T217A possibly damaging Het
Igkv5-48 A G 6: 69,726,826 S32P probably benign Het
Itgax C A 7: 128,148,599 F1062L probably benign Het
Lct G A 1: 128,294,320 T1494I probably damaging Het
Lilra6 G A 7: 3,912,933 T309I probably damaging Het
Mical3 T C 6: 121,034,275 T321A possibly damaging Het
Mmp23 T A 4: 155,652,341 N104I probably damaging Het
Muc3 T C 5: 137,142,390 Y131C probably damaging Het
Naip2 A C 13: 100,162,041 S496A probably benign Het
Ndufs2 A G 1: 171,236,698 S348P probably damaging Het
Nepro T C 16: 44,727,075 S52P probably damaging Het
Nlrp6 A G 7: 140,927,443 E874G possibly damaging Het
Nsmce1 A G 7: 125,491,418 V9A probably benign Het
Olfr13 T C 6: 43,174,066 F27L probably benign Het
Olfr1458 T A 19: 13,102,474 T277S probably benign Het
Olfr357 T C 2: 36,996,995 F62L probably benign Het
Olfr788 A T 10: 129,472,721 I10F possibly damaging Het
Per2 A T 1: 91,429,382 probably null Het
Pgbd1 T C 13: 21,423,476 I183V probably benign Het
Pik3c2g T C 6: 139,730,469 V113A probably benign Het
Pipox A G 11: 77,882,648 L259P probably damaging Het
Pkd1l3 C T 8: 109,638,387 Q1124* probably null Het
Plcd3 A G 11: 103,074,931 S492P possibly damaging Het
Rcor2 T G 19: 7,271,046 M142R probably benign Het
Rwdd3 T C 3: 121,156,452 E115G probably damaging Het
Slc13a3 T C 2: 165,408,898 Y475C probably damaging Het
Slc14a2 A T 18: 78,159,082 I611N possibly damaging Het
Spg11 T C 2: 122,092,305 S888G probably benign Het
Spta1 A T 1: 174,187,148 probably null Het
Stk35 C A 2: 129,810,687 D369E possibly damaging Het
Tanc1 T C 2: 59,807,642 S889P probably damaging Het
Tbc1d10b T C 7: 127,198,878 N697S probably damaging Het
Tcof1 A T 18: 60,814,780 probably null Het
Tg T A 15: 66,671,311 Y25N probably damaging Het
Thbs1 T C 2: 118,119,117 C563R probably damaging Het
Tlr11 A G 14: 50,363,055 S833G possibly damaging Het
Uggt2 T A 14: 119,057,564 H550L probably benign Het
Utp20 A G 10: 88,755,186 probably null Het
Wbp1l T A 19: 46,654,319 L253Q probably damaging Het
Zfp433 T A 10: 81,720,244 S161R possibly damaging Het
Zfp865 A G 7: 5,029,783 T256A probably damaging Het
Zpr1 A G 9: 46,274,711 D160G probably benign Het
Other mutations in Slc25a24
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00709:Slc25a24 APN 3 109159354 missense probably damaging 1.00
IGL01065:Slc25a24 APN 3 109158651 unclassified probably benign
IGL01769:Slc25a24 APN 3 109149500 missense probably damaging 0.99
IGL02803:Slc25a24 APN 3 109155071 missense probably damaging 0.99
IGL03349:Slc25a24 APN 3 109149549 missense possibly damaging 0.67
R0318:Slc25a24 UTSW 3 109157000 missense probably benign 0.00
R0448:Slc25a24 UTSW 3 109157016 splice site probably benign
R1554:Slc25a24 UTSW 3 109136270 missense probably benign 0.02
R1564:Slc25a24 UTSW 3 109163503 missense probably damaging 1.00
R1935:Slc25a24 UTSW 3 109136265 missense probably damaging 1.00
R1936:Slc25a24 UTSW 3 109136265 missense probably damaging 1.00
R4936:Slc25a24 UTSW 3 109163548 missense probably damaging 0.98
R5299:Slc25a24 UTSW 3 109166352 missense probably benign 0.03
R6748:Slc25a24 UTSW 3 109149507 missense possibly damaging 0.67
R7269:Slc25a24 UTSW 3 109158644 missense probably null 0.99
Predicted Primers PCR Primer
(F):5'- AGAAAAGCAGCTAGTCTGTGTCTG -3'
(R):5'- TTCAGTAGTCAACGCTACCTATAG -3'

Sequencing Primer
(F):5'- AGCTAGTCTGTGTCTGGTCTATACAC -3'
(R):5'- GGTGGCTCGGAATCACATATAACTC -3'
Posted On2018-05-21